Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter

Nucleic Acids Res. 1999 Dec 15;27(24):4807-15. doi: 10.1093/nar/27.24.4807.

Abstract

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.

MeSH terms

  • 5' Untranslated Regions / genetics
  • Amino Acid Sequence
  • Animals
  • Base Sequence
  • Binding Sites
  • Cloning, Molecular
  • Colon / metabolism
  • Endometrial Neoplasms
  • Exons
  • Female
  • Gene Expression Regulation, Neoplastic
  • Gene Library
  • Humans
  • Intestine, Small / metabolism
  • Introns
  • Kruppel-Like Transcription Factors
  • Lactoferrin / genetics*
  • Mice
  • Molecular Sequence Data
  • RNA, Messenger / genetics
  • Recombinant Proteins / biosynthesis
  • Recombinant Proteins / chemistry
  • Sequence Alignment
  • Sequence Homology, Amino Acid
  • Sequence Homology, Nucleic Acid
  • Trans-Activators / chemistry
  • Trans-Activators / genetics*
  • Trans-Activators / metabolism*
  • Transcription, Genetic
  • Tumor Cells, Cultured
  • Zinc Fingers

Substances

  • 5' Untranslated Regions
  • KLF5 protein, human
  • Klf5 protein, mouse
  • Kruppel-Like Transcription Factors
  • RNA, Messenger
  • Recombinant Proteins
  • Trans-Activators
  • Lactoferrin

Associated data

  • GENBANK/AF132818