Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation

J Intellect Disabil Res. 2012 Apr;56(4):415-20. doi: 10.1111/j.1365-2788.2011.01479.x. Epub 2011 Sep 29.

Abstract

Background: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported.

Methods: We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing.

Results: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype.

Conclusion: Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.

MeSH terms

  • Adolescent
  • Alleles*
  • Child
  • Child, Preschool
  • Chromosome Deletion
  • Exons / genetics
  • Female
  • Genetic Testing*
  • Genotype*
  • Humans
  • INDEL Mutation / genetics*
  • Intellectual Disability / diagnosis
  • Intellectual Disability / genetics
  • Lebanon
  • Methyl-CpG-Binding Protein 2 / genetics*
  • Phenotype*
  • Polymorphism, Genetic / genetics
  • Rett Syndrome / diagnosis
  • Rett Syndrome / genetics*

Substances

  • MECP2 protein, human
  • Methyl-CpG-Binding Protein 2