Spectroscopic probing of recognition of the G-quadruplex in c-kit promoter by small-molecule natural products

Int J Biol Macromol. 2012 May 1;50(4):996-1001. doi: 10.1016/j.ijbiomac.2012.02.029. Epub 2012 Mar 3.

Abstract

The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities. The melting experiments demonstrate that P1-P4 can significantly enhance the stability of the G-quadruplex with the ordering of P1≈P4>P3>P2. Further insight into the binding mode of small molecules with the G-quadruplex by Autodock3 analysis reveals that P1-P3 prefer the end-stacking mode with the G-quadruplex through π-π interaction and P4 prefers to insert into the groove outside the G-tetrads. Thus, our research finds that four ligands (P1-P4) from small natural molecules have high affinity to, and can significantly enhance the stability of the G-quadruplex in the promoter region of the c-kit oncogene.

Publication types

  • Research Support, Non-U.S. Gov't

MeSH terms

  • Antineoplastic Agents / chemistry
  • Antineoplastic Agents / metabolism
  • Antineoplastic Agents / pharmacology
  • Base Sequence
  • Biological Products / chemistry*
  • Biological Products / metabolism*
  • Biological Products / pharmacology
  • Drug Design
  • G-Quadruplexes* / drug effects
  • Ligands
  • Models, Molecular
  • Prodrugs / metabolism
  • Promoter Regions, Genetic* / drug effects
  • Proto-Oncogene Proteins c-kit / genetics*
  • Spectrum Analysis*

Substances

  • Antineoplastic Agents
  • Biological Products
  • Ligands
  • Prodrugs
  • Proto-Oncogene Proteins c-kit