Interactions between achiral porphyrins and a mature miRNA

Nanoscale. 2024 Mar 7;16(10):5137-5148. doi: 10.1039/d3nr05504c.

Abstract

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.

MeSH terms

  • Circular Dichroism
  • Humans
  • MicroRNAs*
  • Oligonucleotides
  • Porphyrins* / chemistry
  • Zinc

Substances

  • Porphyrins
  • MicroRNAs
  • Zinc
  • Oligonucleotides