Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

J Biol Chem. 1999 Apr 30;274(18):12797-802. doi: 10.1074/jbc.274.18.12797.

Abstract

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.

Publication types

  • Research Support, Non-U.S. Gov't
  • Research Support, U.S. Gov't, Non-P.H.S.
  • Research Support, U.S. Gov't, P.H.S.

MeSH terms

  • Base Sequence
  • DNA / chemistry
  • DNA Helicases / chemistry
  • DNA Helicases / metabolism*
  • Fragile X Syndrome / genetics*
  • Humans
  • Nucleic Acid Conformation*
  • Trinucleotide Repeats*
  • Werner Syndrome / enzymology*

Substances

  • DNA
  • DNA Helicases