Anti-virulence agents against MRSA

AAC Accepts, published online ahead of print on 20 May 2013 Antimicrob. Agents Chemother. doi:10.1128/AAC.00269-13 Copyright © 2013, American Society for Microbiology. All Rights Reserved. Discovery of anti-virulence agents against MRSA 1 2 3 Varandt Khodaverdian1*, Michelle Pesho*, Barbara Truitt2*, Lucy Bollinger3, Parita 4 Patel4, Stanley Nithianantham5, Guanping Yu6 and Menachem Shoham# 5 6 Department of Biochemistry, School of Medicine, Case Western Reserve University, 7 2123 Adelbert Rd, Cleveland, OH 44106-4935, USA 8 9 Running title: Anti-virulence agents against MRSA 10 # Corresponding author. Mailing address: Department of Biochemistry, School of 11 Medicine, Case Western Reserve University, 2123 Adelbert Rd, Cleveland, OH 44106- 12 4935, USA. Phone: 216-368-4665. Fax: 216-368-3419. E-mail: [email protected] 13 14 * 15 1 16 Patterning, Department of Biology, Tufts University, 200 Boston Ave, Medford, MA 17 02155-0108, USA 18 2 19 Case Western Reserve University, 2123 Adelbert Rd, Cleveland, OH 44106-4945, USA. 20 3 Present affiliation, Washington University School of Medicine, St Louis, MO, USA. 21 4 Present affiliation, Case Western Reserve University School of Medicine, Cleveland, 22 OH, USA. 23 5 24 California, One Shields Avenue, Davis, California 95616, USA. 25 6 26 University, Cleveland, OH 44106-7207, USA. These authors contributed equally. Present affiliation, Collaborative Cluster of Genome Stability and Developmental Present affiliation, Department of Epidemiology & Biostatistics, School of Medicine, Present Affiliation, Department of Molecular and Cellular Biology, University of Present affiliation, Department of Biomedical Engineering, Case Western Reserve 27 1 28 ABSTRACT 29 Anti-virulence agents inhibit the production of disease-causing virulence factors but are 30 neither bacteriostatic nor bactericidal. Anti-virulence agents against MRSA strain 31 USA300, the most widespread community-associated MRSA strain in the US, were 32 discovered by virtual screening against the response regulator AgrA, which acts as a 33 transcription factor for the expression of several of the most prominent S. aureus toxins 34 and virulence factors involved in pathogenesis. Virtual screening was followed by 35 similarity searches in databases of commercial vendors. These small-molecule 36 compounds inhibit the production of the toxins α-hemolysin and phenol-soluble modulin- 37 α in a dose-dependent manner without inhibiting bacterial growth. These anti-virulence 38 agents are small-molecule biaryl compounds in which the aromatic rings are either 39 fused or separated by a short linker. One of these compounds is the FDA-approved 40 non-steroidal anti-inflammatory drug diflunisal. This represents a new use for an old 41 drug. Anti-virulence agents might be useful in prophylaxis and as adjuvants in antibiotic 42 therapy of MRSA infections. 2 43 INTRODUCTION 44 Staphylococcus aureus is the most widespread bacterial pathogen in the developed 45 world (2). One third of the population worldwide is thought to be colonized with S. 46 aureus, usually in the nose (3). Colonization is often harmless, but sometimes becomes 47 pathogenic. The trigger for this transition is unknown but seems to be associated with 48 penetration of S. aureus into broken skin, bruises, surgical procedures, insertion of 49 catheters and other indwelling implants and host factors such as local or general 50 immunosuppression (4). S. aureus causes a wide range of infections from skin and soft 51 tissue infections to more invasive infections, such as pneumonia, endocarditis, 52 meningitis, bacteremia and sepsis. 53 The increase in S. aureus infections has been associated with hospitalization, affecting 54 preferentially immunocompromised individuals. However, recently such infections 55 increasingly occur in the community in healthy individuals, such as athletes, students, 56 prisoners, etc. These community-associated infections (CA-MRSA) are generally more 57 virulent than hospital-associated infections (HA-MRSA) (2). 58 Treatment of S. aureus infections is hampered by the steady increase in resistance 59 towards antibiotics. Over two thirds of S. aureus infections are nowadays resistant to 60 methicilin, a second-generation β-lactam antibiotic (3). Vancomycin, linezolid and 61 daptomycin are the antibiotics of last resort against Methicillin-Resistant Staphylococcus 62 Aureus (MRSA). Alarmingly, strains have recently emerged that are resistant even to 63 vancomycin (5). Thus, the development of new antibacterial agents represents an 64 urgent unmet medical need. 65 Virulence factor production in S. aureus is regulated by a quorum sensing mechanism, 66 predominantly under the control of the accessory gene regulator (agr) operon (6). As 67 shown in Figure 1, the autoinducing peptide (AIP) is the signaling molecule coded for by 68 agrD and processed by agrB. Mature AIP is secreted to the cell surface where it binds 69 to and activates the histidine kinase AgrC on the same cell or on another cell. 70 Subsequently, AgrC autophosphorylates and transfers its phosphoryl group to Asp 59 71 on the N-terminal domain of the response regulator protein AgrA. Phosphorylated AgrA 72 undergoes a conformational change to form a dimer, which enables its C-terminal DNA- 73 binding domains to bind to promoter P2 to activate AIP transcription in an autocatalytic 3 74 fashion. When the AIP concentration reaches a certain threshold, AgrA also binds to the 75 tenfold weaker binding promoter P3, which drives the expression of a series of toxins 76 and virulence factors in the post-exponential growth phase (1) . 77 The present work is based on the hypothesis that blocking AgrA phosphorylation by 78 using small-molecule compounds would inhibit toxin production. Top-scoring 79 compounds identified through virtual screening against the phosphoryl-binding pocket 80 on AgrA were selected for in vitro screening of toxin suppression in MRSA strain 81 USA300 at the protein and RNA levels. More such compounds were discovered by 82 substructure searches in on-line catalogs of chemical vendors. The best compounds 83 inhibit rabbit blood hemolysis by 98% at a concentration of 10 µg/mL. These 84 compounds may provide the basis for the development of anti-virulence agents to 85 combat MRSA. 86 4 87 MATERIALS AND METHODS 88 Homology model building of the N-terminal regulatory domain of AgrA. Since 89 there is no crystal structure available for the N-terminal regulatory domain of the S. 90 aureus response regulator AgrA a model was built by homology to the crystal structure 91 of the regulatory domain of the Sigm54 transcription activator Ntrc1 from Aquifex 92 aeolicus (PDB code 1NY5, 2.4 Å resolution) (7). Residues 1-125 of AgrA (UniprotKB 93 code C5MZ29, S. aureus strain USA300_TCH959) were subjected to model building by 94 the SwissModel server (8) followed by refinement with program CNS (9). 95 Virtual screening. The National Cancer Institute library of 90,000 small-molecule 96 compounds was screened virtually using the Schrodinger software suite on the High 97 Performance Computing Cluster at Case Western Reserve University. Program GLIDE 98 was used for docking the compounds, one at a time, onto the phosphoryl-binding pocket 99 of AgrA, delineated by a 10Å cube centered on the phosphoryl-acceptor residue Asp59. 100 The 107 top-scoring compounds were selected for in vitro testing. Additional small- 101 molecule compound candidates for in vitro testing were identified by similarity and 102 substructure searches at online catalogs of chemical vendors. A total of 250 compounds 103 were acquired and subjected to in vitro testing. 104 ELISA for α-hemolysin (Hla). MRSA strain USA300 was cultured overnight at 37° in 105 1.5 mL Trypticase Soy Broth (TSB). The overnight culture was diluted 1 to 100 and 106 aliquots of 2 mL were added to designated incubation tubes, followed by the addition of 107 40 μL of 0.05 mg/mL, 0.5 mg/mL or 2.5 mg/mL of a compound in 100% DMSO to yield 108 final concentrations of 1 µg/mL, 10 μg/mL, and 50 µg/mL compound, respectively. 40 μL 109 of 100% DMSO was added to a control incubation tube. The concentration of DMSO in 110 the growth samples was ≤2%. The tubes were placed in a shaker and incubated at 37° 111 for 6 h. Bacterial cultures were drawn into a syringe and filtered through a 0.22 µ filter. 112 The filtrates are stored at -80° until used for the ELISA. 113 Microtiter 96-well plates (EIA/RIA Costar #9017) containing 100 μL/well of a polyclonal 114 anti-Hla antibody (Abcam #ab15948), diluted 1:1000 using PBS, pH 7.2, were incubated 115 overnight at 4o. The supernatant was then removed and a Bovine Serum Albumin (BSA) 116 block was conducted for 60 min at 4o using 230 μL of 10 mg/mL BSA in PBS (Sigma 117 P3688). The supernatant was removed and the plate washed once with 230 μL 0.05% 5 118 Tween20 in PBS (Sigma P3563). 100 μL of the test samples (filtered supernatants of 119 bacterial cultures, diluted 1:8 or 1:16 with PBS) were added to the wells and incubated 120 for 1 h at room temperature with gentle rocking, followed by three washes with 230 μL 121 0.05% Tween20 in PBS. 100 μL of the HLA antibody conjugated to horseradish 122 peroxidase (Abcam ab15949), diluted 1:1000 in 10mg/ml BSA, PBS (Sigma P3688), 123 was then added to the wells and incubated for 1 h with rocking. Three more washes 124 with 230 μL of 0.05% Tween20 in PBS were conducted, ensuring there were no 125 supernatant left after the third wash. The plate was subsequently washed twice with 230 126 μL PBS, pH 7.2 and allowed to drain on paper towels. 100 μL of substrate solution 127 3,3’,5,5’ tetramethylbenzidine (TMB) (Sigma T4444) was added to each well, the plates 128 were incubated at room temperature for 10 min, followed by the addition of 100 μL of 129 stop reagent (Sigma S5689). OD650 nm was measured in a microplate reader, and 130 percent inhibition was calculated relative to the solvent DMSO. 131 In order to account for differences in bacterial growth in the presence of the compounds 132 the number of colony forming units in each sample was measured after 6 h of growth. 133 Cultures were serially diluted, spread onto LB agar plates and incubated overnight at 134 37o. The number of colonies on each plate was counted. Hla inhibition data were 135 normalized to bacterial growth with DMSO devoid of any potential inhibitor. 136 137 Rabbit blood hemolytic assay. This functional assay measures hemoglobin release 138 from erythrocytes due to the hemolytic activity of Hla. Cultures of MRSA strain USA300 139 were grown at 37 º for 16-18 h with shaking to post-exponential growth phase (OD600 nm 140 = 2.5, equivalent to 1 × 109 CFU/mL). Compounds were added at various concentrations 141 and incubated for 6 h at 37º. Samples of 100 μL bacterial culture were filtered and 142 added to 900 μL hemolysin buffer (0.145 M NaCl, 0.02 M CaCl2) and 25 μL of 143 defibrinated rabbit blood (HemoStat Laboratories, Dixon, CA). The solution was 144 incubated for 15 min at 37 º. Unlysed blood cells were pelleted by centrifugation (5,500 145 × g, room temperature, 1 min). The hemolytic activity of the supernatant was 146 determined by measuring the optical density at 541 nm. Sterile culture medium served 147 as 0% hemolysis, and bacterial culture supernatant devoid of any inhibitor (control) was 6 148 designated as 100% hemolysis. Percent hemolysis inhibition was calculated by 149 comparison with the control culture. Assays were performed in triplicate. 150 151 RNA isolation 152 Total RNA from MRSA strain USA300 was isolated after 6 h of induction using the 153 RiboPure – Bacteria RNA isolation kit (Ambion, Life Technologies) according to 154 manufacturer’s instructions with additional DNase I treatment. RNA yield and purity was 155 assessed by measuring the ratio of UV absorbance at 260 and 280 nm as described by 156 the manufacturer. The integrity of the RNA was assessed on a 1% denaturing agarose 157 gel. High integrity RNA had two clear bands without smearing, indicating no 158 fragmentation of 23s and 16s rRNA. 159 160 Real time RT-PCR 161 qRT-PCR was conducted on RNA isolates and the level of hla, psm-α, RNAIII and spa 162 was assessed. The data was analyzed using the ΔΔCt method with samples induced 163 with 2% DMSO as the control. The gene corresponding to the DNA-binding protein hup 164 was used as the reference housekeeping gene. 165 Real-time RT-PCR reactions were conducted using SYBR – green mix (iScript One- 166 Step RT-PCR Kit with SYBR Green, Bio-Rad). Each reaction tube contained 12.5 μL 167 master mix, 0.5 μL reverse transcriptase, 7 μL pooled forward and reverse primer, and 168 5 μL (~1 ng total RNA). The cycling program was as designated by the manufacturer 169 with an annealing and extension temperature of 56°C. Primer sequences are listed in 170 Table 1. 171 172 AgrA preparation 173 Plasmid pJR28 containing AgrA and an amino-terminal hexa-histidine tag was a gift of 174 Jonathan Reynolds and Sivaramesh Wigneshweraraj from Imperial College, London, 175 UK. AgrA was expressed in E. coli using the pET28b expression vector as described 176 previously (10). Briefly, cells were grown at 25o C and the protein was expressed 177 without IPTG induction to prevent accumulation in inclusion bodies. Cells were lysed by 178 osmotic shock in 50 mM HEPES pH 7.3, 300 mM NaCl, 5% glycerol and 3 mM 7 179 β−mercaptoethanol. The lysate was loaded onto a pre-equilibrated nickel affinity column 180 (His-Trap, GE Healthcare) and washed with lysis buffer plus 10 mM imidazole. The 181 protein was eluted with same buffer plus 250 mM imidazole, which migrated as a single 182 band of 28 kDa on SDS-PAGE. The identity of the protein was confirmed by mass 183 spectrometry (data not shown). 184 185 Electrophoretic mobility shift assay (EMSA) 186 The assay was modified from the method described by Koenig et al (1). The DNA 187 sequences used were the P3 promoter region 188 (AATTTTTCTTAACTAGTCGTTTTTTATTCTTAACTGTAAATTTTT) and the negative 189 control (CCTGGTTGTCCTCGTCACTATGAAGAGCCTCACACACAAGGTCGTCGA) as 190 in (1). Single strands were synthesized, purified by denaturing polyacrylamide gel 191 electrophoresis, and end-labeled with 32P. The complimentary oligomers were then 192 annealed and the duplex was purified with native polyacrylamide gel electrophoresis. To 193 show AgrA binding, limiting concentrations of DNA (1 nM) were allowed to equilibrate 194 with varying concentrations of AgrA at 25oC for 30 min in a 20 µL solution initially 195 containing 50 mM acetyl phosphate and reaction buffer composed of 10 mM HEPES, 196 pH 7.6, 1 mM EDTA, 2 mM DTT, 50 mM KCL, 0.05% Triton X-100 and 5% glycerol. As 197 it became evident that acetyl phosphate is not required to form a specific AgrA-DNA 198 complex it was subsequently left out. EMSAs were performed using 4.5% native 199 polyacrylamide gels in 0.5x Tris borate-EDTA. Gels were run at 5 W at 4o C. The assay 200 with diflunisal was performed similarly, except that diflunisal was incubated with AgrA, 201 DNA and reaction buffer for 5 min prior to loading the gel. Finished gels were visualized 202 by phosphorimaging (Amersham Biosciences Storm 840 scanner) and ImageQuant 203 software. 8 204 205 RESULTS 206 207 AgrA model 208 The target protein for the discovery of small-molecule compounds to inhibit S. aureus 209 virulence factors in this work is the regulatory domain of the response regulator AgrA. 210 Crystal structures of the C-terminal DNA-binding domain of AgrA by itself and in 211 complex with a cognate DNA fragment have been reported (11, 12). However, no 212 crystal structure of the N-terminal regulatory domain of AgrA is available. Therefore we 213 resorted to homology model building. A model of the N-terminal regulatory domain of 214 AgrA, residues 1-125 was built by homology to the N-terminal domain of the 215 transcription regulator Ntrc1 from Aquifex aeolicus (PDB code 1ZY2) (7). Although the 216 degree of sequence identity between the two protein domains is only 26% they share 217 functional similarities, including the aspartic acid phosphoryl receiver (Asp59 in AgrA) 218 embedded in the conserved sequence motif XDY, where X is a an aliphatic or aromatic 219 residue, D is an aspartic acid and Y is an aliphatic residue. This motif is conserved in 220 the activation domains of transcriptional regulators of Gram-positive bacteria. It is only 221 the structure of the phosphoryl-binding pocket that is used for virtual screening of 222 inhibitors, not the structure of the entire domain. Therefore, this crystal structure was 223 deemed a valid basis for building a model of the phosphoryl-binding pocket on the N- 224 terminal domain of AgrA. The homology-generated model of the N-terminal domain of 225 AgrA displays a distinct surface pocket centered on Asp59, as shown in Figure 2. The 226 dimensions of the pocket are roughly 10 x 10 x 10 Å. Residues lining the binding pocket 227 include Glu 7, Asp 8, Asp 9, Gln 12 (H-bonded to Asp 59), Leu 62, Val 87 and Lys 110 228 (salt bridged to Asp 59). 229 High throughput virtual screening 230 The National Cancer Institute library of 90,000 small-molecule compounds was 231 screened virtually to block the phosphoryl-binding pocket of AgrA. The 107 top-scoring 232 compounds were acquired and tested for in vitro efficacy in inhibiting the formation of α- 233 hemolysin (Hla), the most important S. aureus toxin (13-16). 234 Inhibition of α-hemolysin (Hla) formation by potential inhibitors. 9 235 Activation of AgrA leads to increased Hla production. Therefore, as an initial measure of 236 AgrA inhibition, Hla levels were measured by a sandwich ELISA. Seven of the top- 237 scoring 107 compounds from virtual screening were found to inhibit Hla production. 238 Substructure searches were conducted at online catalogs of chemical vendors to find 239 additional compounds similar to the initial positive hits. A total of 250 compounds were 240 assayed for inhibition of Hla production. Compounds that inhibited bacterial growth were 241 not further examined. The eleven most active compounds, defined by the highest 242 inhibition of Hla, belong to two families, naphtalene derivatives and biaryl compounds, 243 as shown in Figure 3. At 10 µg/mL, four compounds inhibited Hla formation by more 244 than 70%, with all the compounds inhibiting Hla in a dose dependent manner (Table 2). 245 The ELISA inhibition data were corroborated by a hemolysis assay. Hla creates holes in 246 membranes of various host cells, such as immune system cells and erythrocytes. 247 Interestingly, Hla does not affect human red blood cells but does damage rabbit and 248 sheep erythrocytes. Rabbit erythrocytes were used for the hemolysis assay. The 249 amount of hemoglobin released from lysed red blood cells was taken as a measure of 250 Hla production. Of the tested compounds, all resulted in a marked decrease of 251 hemolysis at both 1 µg/mL and 10 µg/mL and appear to inhibit in a dose dependent 252 manner (Table 2). The highest degree of inhibition was observed with compounds VI 253 and IX, which decreased hemolysis by more than 97% at a concentration of 10 µg/mL. 254 These compounds are neither bactericidal nor bacteriostatic. None of these compounds 255 inhibited growth at 1 or 10 µg/mL. 256 Transcription inhibition of agr-regulated toxin genes by anti-virulence 257 compounds 258 To shed light on the mechanism of Hla inhibition RT-qPCR experiments were carried 259 out in the presence of selected anti-virulence compounds. When MRSA was incubated 260 in the presence of 50 μg/mL of the compounds, a marked decrease of hla expression 261 was observed in particular with compounds IX, X and XI (Figure 4A). Furthermore, a 262 decrease of at least twofold was observed for all the compounds at 10 µg/mL (except 263 for compound V). Compound IX elicited the most dramatic inhibition of the Hla transcript 264 by a factor of about 1000 at a concentration of 50 µg/mL. This inhibition of hla is 265 consistent with the model of AgrA inhibition. 10 266 Hla transcription is indirectly upregulated by phosphorylated AgrA, whereas regulatory 267 RNAIII and the leuokolytic protein phenol-soluble modulin α (PSMα) are directly 268 upregulated by binding of phosphorylated AgrA to their respective promoters (6, 23). 269 Therefore, RNAIII and psmα expressions are thought to directly correlate to AgrA 270 activation, and subsequently, inhibition. When incubated with select anti-virulence 271 compounds, psmα expression significantly decreased at 50 µg/mL (Figure 4B). All of 272 the investigated compounds inhibited transcription of Hla and PSM-α in a dose 273 dependent manner, as shown in Figures 4A and 4B (except for compound XI). 274 RNAIII expression was only moderately inhibited when MRSA was incubated with 275 compounds V, VII, and IX at 50 µg/mL. Only compound IX decreased RNAIII expression 276 at 10 µg/mL. In contrast to the downregulation of the toxins, expression of the 277 antiphagocytic surface protein A was increased in the presence of the compounds 278 (Figure 4D). 279 Inhibition of AgrA binding to promoter P3 by an anti-virulence compound 280 In an effort to gain insight into the mechanism of action of the anti-virulence compounds 281 DNA-binding experiments were carried out with purified AgrA and an oligonucleotide 282 corresponding to promoter P3, which drives the expression of virulence factors in S. 283 aureus. As shown in lane 2 of Figure 5 a strong band appears upon the addition of AgrA 284 to the DNA fragment corresponding to the AgrA-P3 complex. The band corresponding 285 to this complex is not present when diflunisal (compound IX) is added (lane 3), 286 indicating inhibition of specific binding of AgrA to promoter P3 by the antivirulence 287 compound. Similar DNA-binding inhibition was observed with other compounds (data 288 not shown) that will be described in a follow-up publication. Thus, the compounds inhibit 289 the transcription of virulence factors by preventing the response regulator transcription 290 factor from binding to the promoter driving the expression of virulence factors. 291 292 DISCUSSION 293 Antibiotics are currently the treatment of choice for MRSA infections, but increasing 294 resistance to these agents, coupled with the decline in commercial development of new 295 antibiotics, has created an urgent need and a window of opportunity to introduce new 296 treatment options. The World Health Organization has identified antimicrobial resistance 11 297 as one of the three greatest threats to human health. Anti-virulence agents offer an 298 alternative to antibiotics. Will there be resistance development to anti-virulence agents? 299 Virulence factors empower the pathogen with chemical weapons, which impair the host 300 immune system’s ability to fight an infection. Since the survival of bacteria is not 301 threatened by anti-virulence treatment, it is conceivable that resistance to these agents 302 will not significantly impede the efficacy of the drug over time. At present there are no 303 data to support this assumption. One might argue that anti-virulence therapy, by 304 suppressing pathogen–host interactions, does create selective pressure, since it 305 renders the pathogen susceptible, once again, to innate immunity. The key is that this 306 selective pressure is only present in areas where innate immunity is active. There is no 307 selective pressure on the commensal flora of nonvirulent bacteria or when the drug is 308 released into the environment (17). Thus, anti-virulence therapy could help to preserve 309 the efficacy of conventional antibiotics. 310 There is currently no anti-virulence agent in clinical use against bacterial infections. 311 However, data are available on animal models of S. aureus infections that shed light on 312 the usefulness of anti-virulence agents to combat infections. Hla is an essential 313 virulence factor of S. aureus, and its level correlates with virulence in a mouse model of 314 S. aureus pneumonia (18). Monoclonal antibodies against Hla provide protection 315 against lethal S. aureus pneumonia in an experimental murine model and prevent 316 human lung cell injury in vitro (19). However, once the animals are infected, treatment is 317 effective when administered up to 8 h post infection. Likewise, a β-cyclodextrin 318 derivative that blocks the oligomeric assembly of Hla and inhibits its lytic function 319 reduces the severity of MRSA infections in a murine model of S. aureus pneumonia 320 (20). As in the case of monoclonal anti-Hla antibodies, treatment with the β-cyclodextrin 321 derivative at 10 mg/kg is of limited value post infection since the efficacy drops when 322 administered beyond 2 h post infection. However, active or passive immunization 323 against Hla in a murine model reduces the severity of skin and soft tissue infections 324 caused by MRSA strain USA300, the leading cause of community-associated MRSA 325 infections in the United States (15). 326 In contrast to anti-Hla agents, which neutralize the action of a single toxin, the 327 compounds discovered in this work inhibit the expression of Hla, Psm-α and to some 12 328 extent RNAIII. Along with Hla, Psm-α isakeyvirulencefactor in S. aureus infections (14). 329 Hla and Psm-αare toxins with complementary lytic activity against the host. Whereas 330 Psm-α is more efficacious in lysing neutrophils (21), Hla is more lytic to erythrocytes in 331 rabbits, mice and sheep but not in humans (22). Hla’s major contribution to 332 pathogenesis in humans is exerted by virtue of its interaction with the metalloprotease 333 ADAM10, which leads to disruption of epithelial barrier function (13). 334 The agr operon is the most important operon for virulence production in S. aureus. 335 Knockout of the agr operon in MRSA strain USA300 drastically reduces the size of 336 abscesses in a rabbit model of skin infections (14). 337 Inhibition of the agr system can in principal be achieved by blocking any step along the 338 pathway shown in Figure 1. The receptor histidine kinase AgrC was the target of a 339 synthetic approach to inhibit receptor activation by cyclic peptide mimics of the 340 autoinducing peptide (23). Inhibitory antibodies have been shown to cause agr 341 quenching by sequestering the autoinducing peptide (24). The target of agr inhibition in 342 this work was the transcription factor AgrA, which controls the expression of all the 343 virulence factors under the control of the agr system. Hla is upregulated by AgrA. In the 344 presence of the anti-virulence compounds described in this work there is a marked 345 decrease in Hla production as shown by ELISA and rabbit blood hemolysis. 346 Furthermore, a significant decrease in transcription of Hla was observed by RT-qPCR. 347 In addition, some of the compounds were shown to significantly inhibit psm-α 348 expression, a toxin directly upregulated by phosphorylated AgrA in an RNAIII- 349 independent manner (25). Interestingly, the decrease in rnaIII expression was not as 350 large as for hla and psm-α. This may be explained by differential binding of AgrA to 351 promoters in other operons, such as sar that trigger higher expression levels (26, 27). 352 This finding is corroborated by a report that induction of Hla transcription is not coupled 353 to higher concentrations of RNAIII (28). Whereas the expression of the toxins Hla and 354 Psm-α is inhibited, the expression of the immune evasion protein A (spa) is upregulated 355 by the anti-virulence compounds. This finding is in accordance with a previous report of 356 downregulation of protein A when agr is upregulated (25). Whereas an increase in 357 immune evasion is an undesirable effect it is counterbalanced by a marked decrease in 13 358 disease-causing toxins. Thus, the overall consequence of anti-virulence therapy may be 359 a reduction in the severity of the infection. 360 Diflunisal, compound IX, is an FDA-approved non-steroidal anti-inflammatory drug. This 361 represents a new use for an old drug. Diflunisal inhibits AgrA binding to an 362 oligonucleotide corresponding to the DNA sequence of promoter P3, as shown in Figure 363 5. Blocking the formation of the specific protein-DNA complex could in principal be 364 achieved by binding of diflunisal either to DNA or to AgrA. The latter is considered more 365 likely. It is conceivable that diflunisal causes a conformational change on AgrA that 366 impedes its DNA-binding capacity. Perhaps diflunisal prevents proper dimerization of 367 AgrA required for specific promoter binding (10). 368 The drug discovery target for this project was the phosphoryl-binding pocket on the N- 369 terminal domain of AgrA. However, AgrA binding to promoter P3 does not require 370 phosphorylation (1), a finding corroborated in this work by the formation of a specific 371 AgrA-DNA complex in the absence of acetyl phosphate or any other phosphate donor 372 (Figure 5). Thus, diflunisal may or may not bind to the phosphoryl-binding pocket on 373 AgrA. Recently a ligand-binding pocket has been identified on the C-terminal DNA- 374 binding domain of AgrA (12). Thus, it is possible that diflunisal binds to the C-terminal 375 domain or perhaps to both domains of AgrA. Localization of the diflunisal-binding site on 376 the surface of AgrA will have to await a cocrystal structure of AgrA and diflunisal. 377 The antivirulence compounds discovered in this work may lead to the development of 378 adjuvants to conventional antibiotic therapy or perhaps to novel antimicrobials in 379 monotherapy for topical applications. 380 381 ACKNOWLEDGEMENTS 382 This work was supported by grant-in-aid 09GRNT2380131 from the American Heart 383 Association Great Rivers Affiliate and by a grant from the Steris Foundation. Dr. Robert 384 Bonomo is thanked for invaluable advice and thoughtful discussions. Drs. Jonathan 385 Reynolds and Sivaramesh Wigneshweraraj from Imperial College, London, UK, are 386 thanked for the AgrA expression plasmid. 387 14 388 REFERENCES 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. Koenig RL, Ray JL, Maleki SJ, Smeltzer MS, Hurlburt BK. 2004. Staphylococcus aureus AgrA Binding to the RNAIII-agr Regulatory Region. J Bacteriol 186:7549-7555. Otto M. 2010. Basis of Virulence in Community-Associated Methicillin-Resistant Staphylococcus aureus. Ann Rev Microbiol 64:143-162. Lowy FD. 1998. Staphylococcus aureus Infections. New Engl J Med 339:520532. Rasmussen RV, Fowler Jr VG, Skov R, Bruun NE. 2010. Future challenges and treatment of Staphylococcus aureus bacteremia with emphasis on MRSA. Future Microbiol 6:43-56. Pantosti A, Sanchini A, Monaco M. 2007. Mechanisms of antibiotic resistance in Staphylococcus aureus. Future Microbiol 2:323-334. Novick RP, Projan SJ, Kornblum J, Ross HF, Ji G, Kreiswirth B, Vandenesch F, Moghazeh S, Novick RP. 1995. Theagr P2 operon: An autocatalytic sensory transduction system in Staphylococcus aureus. Mol Gen Genet 248:446-458. Lee SY, De La Torre A, Yan D, Kustu S, Nixon BT, Wemmer DE. 2003. Regulation of the transcriptional activator NtrC1: structural studies of the regulatory and AAA+ ATPase domains. Gene Dev 17:2552-2563. Arnold K, Bordoli L, Kopp Jr, Schwede T. 2006. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22:195-201. Brunger AT, Adams PD, Clore GM, DeLano WL, Gros P, Grosse-Kunstleve RW, Jiang JS, Kuszewski J, Nilges M, Pannu NS, Read RJ, Rice LM, Simonson T, Warren GL. 1998. Crystallography & NMR system: A new software suite for macromolecular structure determination. Acta Crystallog D, Biol Crystallogr 54:905. Reynolds J, Wigneshweraraj S. 2011. Molecular insights into the control of transcription initiation at the Staphylococcus aureus agr operon. J Mol Biol 412:862-881. Sidote DJ, Barbieri CM, Wu T, Stock AM. 2008. Structure of the Staphylococcus aureus AgrA LytTR Domain Bound to DNA Reveals a Beta Fold with an Unusual Mode of Binding. Structure 16:727-735. Leonard PG, Bezar IF, Sidote DJ, Stock AM. 2012. Identification of a Hydrophobic Cleft in the LytTR Domain of AgrA as a Locus for Small Molecule Interactions That Inhibit DNA Binding. Biochemistry 51:10035-10043. Inoshima I, Inoshima N, Wilke GA, Powers ME, Frank KM, Wang Y, Bubeck Wardenburg J. 2011. A Staphylococcus aureus pore-forming toxin subverts the activity of ADAM10 to cause lethal infection in mice. Nat Med 17:1310-1314. Kobayashi SD, Malachowa N, Whitney AR, Braughton KR, Gardner DJ, Long D, Wardenburg JB, Schneewind O, Otto M, DeLeo FR. 2011. Comparative Analysis of USA300 Virulence Determinants in a Rabbit Model of Skin and Soft Tissue Infection. Journal of Infectious Diseases 204:937-941. Kennedy AD, Bubeck Wardenburg J, Gardner DJ, Long D, Whitney AR, Braughton KR, Schneewind O, DeLeo FR. 2010. Targeting of alpha-hemolysin 15 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. by active or passive immunization decreases severity of USA300 skin infection in a mouse model. J Infec Dis 202:1050-1058. Wilke GA, Wardenburg JB. Role of a disintegrin and metalloprotease 10 in Staphylococcus aureus alpha-hemolysin-mediated cellular injury. Proc Natl Acad Sci USA 107:13473-13478. Rasko DA, Sperandio V. 2010. Anti-virulence strategies to combat bacteriamediated disease. Nat Rev Drug Discov 9:117-128. Bubeck Wardenburg J, Schneewind O. 2008. Vaccine protection against Staphylococcus aureus pneumonia. J Exp Med 205:287-294. Ragle BE, Bubeck Wardenburg J. 2009. Anti-alpha-hemolysin monoclonal antibodies mediate protection against Staphylococcus aureus pneumonia. Infect Immun 77:2712-2718. Ragle BE, Karginov VA, Bubeck Wardenburg J. 2010. Prevention and treatment of Staphylococcus aureus pneumonia with a beta-cyclodextrin derivative. Antimicrob Agents Ch 54:298-304. Loeffler B, Hussain M, Grundmeier M, Brueck M, Holzinger D, Varga G, Roth J, Kahl BC, Proctor RA, Peters G. 2010. Staphylococcus aureus pantonvalentine leukocidin is a very potent cytotoxic factor for human neutrophils. PLoS Pathog 6:e1000715. Bernheimer AW. 1965. Staphylococcal alpha toxin. Ann NY Acad Sci 128:112123. George EA, Novick RP, Muir TW. 2008. Cyclic Peptide Inhibitors of Staphylococcal Virulence Prepared by Fmoc-Based Thiolactone Peptide Synthesis. J Am Chem Soc 130:4914-4924. Park J, Jagasia R, Kaufmann GF, Mathison JC, Ruiz DI, Moss JA, Meijler MM, Ulevitch RJ, Janda KD. 2007. Infection Control by Antibody Disruption of Bacterial Quorum Sensing Signaling. Chem Biol 14:1119-1127. Queck SY, Jameson-Lee M, Villaruz AE, Bach T-HL, Khan BA, Sturdevant DE, Ricklefs SM, Li M, Otto M. 2008. RNAIII-Independent Target Gene Control by the agr Quorum-Sensing System: Insight into the Evolution of Virulence Regulation in Staphylococcus aureus. Mol Cell 32:150-158. Cheung AL, Ying P. 1994. Regulation of alpha- and beta-hemolysins by the sar locus of Staphylococcus aureus. J Bacteriol 176:580-585. Saïd-Salim B, Dunman PM, McAleese FM, Macapagal D, Murphy E, McNamara PJ, Arvidson S, Foster TJ, Projan SJ, Kreiswirth BN. 2003. Global Regulation of Staphylococcus aureus Genes by Rot. J Bacteriol 185:610619. Ohlsen K, Koller KP, Hacker J. 1997. Analysis of expression of the alpha-toxin gene (hla) of Staphylococcus aureus by using a chromosomally encoded hla::lacZ gene fusion. Infect Immun 65:3606-3614. Even S, Charlier C, Nouaille S, Ben Zakour NL, Cretenet M, Cousin FJ, Gautier M, Cocaign-Bousquet M, Loubiere P, Le Loir Y. 2009. Staphylococcus aureus virulence expression is impaired by Lactococcus lactis in mixed cultures. Appl Environ Microbiol 75:4459-4472. Vaudaux P, Francois P, Bisognano C, Kelley WL, Lew DP, Schrenzel J, Proctor RA, McNamara PJ, Peters G, Von Eiff C. 2002. Increased expression 16 480 481 482 483 484 of clumping factor and fibronectin-binding proteins by hemB mutants of Staphylococcus aureus expressing small colony variant phenotypes. Infect Immun 70:5428-5437. 485 17 486 Gene Forward Reverse Reference hup AGAAGCTGGTTCAGCAGTAGATG TACCTCAAAGTTACCGAAACCAA (29) hla ATGGATAGAAAAGCATCCAAACA TTTCCAATTTGTTGAAGTCCAAT (29) agrA CCTCGCAACTGATAATCCTTATG ACGAATTTCACTGCCTAATTTGA (29) RNAIII TTCACTGTGTCGATAATCCA TGATTTCAATGGCACAAGAT (30) Psm-α TATCAAAAGCTTAATCGAACAATTC CCCCTTCAAATAAGATGTTCATATC (25) spa TTAAAGACGATCCTTCAGTGAGC TGTTGTTGTCTTCCTCTTTTGGT (29) 487 488 Table 1. Primers used in the qRT-PCR experiments 489 490 491 18 492 493 494 Table 2. MRSA USA300 inhibitors of α-hemolysin formation and rabbit blood hemolysis I ELISA α−hemolysin inhibition 1 µg/mL 28.0±4.4 ELISA α−hemolysin inhibition 10 µg/mL 65.0±2.5 Rabbit blood hemolysis inhibition 1 µg/mL ND Rabbit blood hemolysis inhibition 10 µg/mL ND II 21.3±5.2 76.0±1.2 42.0 ± 2.8 69.9 ± 6.1 III 20.8± 3.5 28.3±3.4 ND ND IV 40.2±5.2 73.6±2.2 ND ND V 23.0±1.3 88.4±1.5 9.0 ± 1.3 63.6 ± 6.6 VI 55.2 ± 5.8 76.3±11.2 9.2 ± 0.7 97.9 ± 9.3 VII 31.3 ± 9.0 61.0±14.8 38.6 ± 6.4 55.6 ± 9.3 VIII 15.9 ± 4.2 41.9±8.2 6.0 ± 7.5 21.3 ± 6.1 IX 33.0 ± 3.6 62.3 ± 1.8 63.0 ± 1.9 97.7 ± 4.2 X 49.4 ± 4.6 53.0 ± 5.9 34.3 ± 6.9 84.7 ± 6.7 XI 0.0 ± 7.0 68.8 ± 11.3 49.0 ± 2.2 76.6 ± 8.1 Compound 495 496 ELISAs were carried out in 2% DMSO as solvent. Control measurements with this 497 solvent were arbitrarily assigned 0% inhibition and 100% bacterial growth. All other data 498 were normalized to control solvent data. 499 ND, not determined. 500 19 501 Figure 1 Figure 1: S. aureus agr operon for toxin production. The cyclic autoinducing peptide (AIP) is the signaling molecule coded for by agrD and processed by agrB. Mature AIP is secreted to the cell surface where it binds to and activates the histidine kinase AgrC on the same cell or on a different cell. Consequently, AgrC autophosphorylates and transfers its phosphoryl group to Asp 59 on the N-terminal domain of the response regulator protein AgrA. Phosphorylated AgrA undergoes a conformational change to form a dimer, which enables its C-terminal DNA-binding domains to bind to promoter P2 to activate AIP transcription in an autocatalytic fashion. When the AIP concentration reaches a certain threshold AgrA also binds to the tenfold weaker promoter P3, which drives the transcription of RNAIII, a master regulator of expression a series of toxins and virulence factors in the post-exponential growth phase (1). RNAIII encodes the hemolysin δ toxin (hld). The drug discovery target in this work is the inhibition of phosphoryl transfer to AgrA, as indicated by the green X. 20 502 503 504 505 506 507 508 509 510 511 Figure 2 Figure 2. Ribbon diagram of the homology-built model of the N-terminal domain of AgrA (AgrA_N). Residue Asp 59, shown in stick representation in a pocket on the surface of the protein, is phosphorylated by the histidine kinase AgrC, leading to activation of the C-terminal DNA-binding domain of AgrA, which in turn triggers induction of both the autoinducing peptide (AIP) and RNAIII, ultimately causing transcription of a series of toxin genes. The hypothesis is that blockage of the phospho-histidine pocket with a small molecule prevents toxin expression. 21 512 O OH HN COO- O F OH F OH OH (I) 513 (III) (II) N NH O (V) OH O O O O (IV) 514 OH O OH HO O O F HO O (VII) (VI) 515 OH 516 Figure 3 22 Figure 3. The structures of the most active compounds 517 I, 4-Hydroxybenzo[cd]indol-2(1H)-one; II, β-oxy-naphthoic acid; III, 2,3-difluoro-1-naphthoic acid; IV, 3-[3-(1,3-benzodioxol-5-yl)prop2-enoyl]-2-hydroxycyclohepta-2,4,6-trien-1-one; V, 4-hydroxy-3methoxy-N-(naphthalen-1-ylmethylideneamino)benzamide; VI, 15(ethyl-2,4-dihydroxyphenyl)-2-phenoxyethanone; VII, 3'-fluoro-4'hydroxy-4-biphenylcarboxylic acid; VIII, 5-benzoyl-4-hydroxy-2methoxybenzenesulfonic acid; IX, 2',4'-difluoro-4-hydroxybiphenyl3-carboxylic acid (diflunisal); X, 3-phenyl salicylic acid; XI, 4,4’fluorophenyl benzoic acid 23 518 Figure 4 Figure 4. Transcription levels of hla, psm-α and RNAIII in MRSA strain USA300 when induced with 10 μg/mL (black bars) and 50 μg/mL (white bars) of compounds. No gene expression was determined for compound VI at 50 μg/mL because growth inhibition prevented RNA isolation. Values are averages of three separate experiments with error bars indicating standard deviation. ***p < 0.0005; **p < 0.005, *p < 0.05 A) hla expression is displayed as log2 of relative gene expression. B) psmα expression is displayed as log2 of relative gene expression. C) RNAIII expression displayed as fold change with DMSO having a fold change of 1. Values above 1 depict an increase in expression while values below 1 signify inhibition of expression. D) spa expression is displayed as log2 of relative gene expression. 24 519 520 1 2 3 Figure 5 Figure 5. Electrophoretic mobility shift assay of a 33P-labeled oligonucleotide corresponding to the sequence promoter P3. Lane 1: DNA alone; lane 2: DNA + 2 µM AgrA; lane 3: DNA + 2 µM AgrA + 200 µM diflunisal (compound IX). The strong band in lane 2 at higher molecular weight corresponds to the AgrA-P3 complex. This band is not present when diflunisal is added. The weak bands in lanes 2 and 3 may correspond to non-specific AgrA-DNA complexes. 25