A Detailed Lesson Plan in Science 10: (Genetic Mutation)

A Detailed Lesson Plan in
Science 10
(GENETIC MUTATION)
Prepared By:
CYRIL BAUA CAUILAN
Pre-Service Teacher
Checked By:
Mrs. Catherine Balubal
Cooperating Teacher
I. Objectives:
At the end of the lesson the learners should be able to:
A.) examine different types of mutations;
B.) observe possible effects of mutations, and;
C.) manage issues pertaining to persons suffering from mutation
II. Subject Matter:

A. Topic: HEREDITY: INHERITANCE and VARIATION
B. Sub-Topic: GENETICMUTATION
C. Reference: Science – Grade 10, Support Material for Independent
Learning Engagement (SMILE)
Quarter 3 – Module 4: PROTEINS and GENETIC
MUTATION, Science 10 Learners Material Unit 3
D. Materials: Powerpoint, Pictures, Learning Module

E. Teaching Strategy: Constructivist, Collaborative, Spiral Progression
Approach, Developmentally Appropriate,
Responsive and Relevant
F. Time Allotment: 60 minutes
III. Learning Procedure

Teachers Activity Student Activity
Preliminary Activities
• Prayer (call a student)
• Greetings
• Classroom Management
• Attendance
Before we start, Diomar can you Place ourselves in the Lord's

presence. In the name of the father,
please lead the prayer.
the son, and the Holy Spirit, amen.
God, thank you for such a beautiful
day. In our online lesson, please
guide us. Please share your
blessings and love with us. Give us
the strength we need to succeed in
our online class. Through Jesus
Christ, this is our prayer. Amen...
Good morning class Good morning, sir
Please be reminded and observe
always our classroom management
For your attendance I will just

download it through the google
attendance tracker.
Excellent! You've got an excellent
attendance record.
Did I give an assignment last meeting?
Okay let’s answer those questions. Yes sir
Gene1:
TACTTGTTTACATAACTTTGAATT
Step 1. Transcribe the DNA to mRNA
AUGAACAAAUGUAUUGAAACUUAA
Step 2. Draw lines to separate the
mRNA into codons (3 bases). AUG-AAC-AAA-UGU-AUU-GAA-
ACU-UAA
Step 3. Using the newly made mRNA,
translate it into its corresponding Start Codon (Methionine)-
protein fragment. Refer to Figure 1 Asparagine-Lysine-Cysteine-
(The Genetic Code Table). Don't forget Isoleucine-Glutamic Acid-Threonine-
to look for the start and stop codon. Stop Codon
Very good class that you were able to
master how to transcribe DNA into
RNA and translate RNA into proteins
Recalling Activity
What was our lesson last meeting?

Sir, we discussed about the central
dogma.
What else class?
We also discussed about the protein
synthesis sir
What is protein synthesis?
It is the process of making proteins
which involves transcription and
Very good class that you can still translation
remember our topic last discussion
though we did not meet last week due
to your Intramurals
Motivation
Class, before we start to our lesson for

today, let’s have a short game first.
Who among from the class are fonds

of watching movies? (Students will raise their hands) or
they will answer Yes
Okay, that’s good, because our activity
for today is related to movies. So, let
us call our game as “GUESS WHO”.
I have here a picture of movies and I

want you to identify and guess who
are in the pictures.
Are you ready? (Showing some Yes sir
pictures)
Teenage Ninja Turtles Sir
Very Good.
How about Its Hulk sir
this one?
X-Men sir
Excellent how about this last picture?
They all possessed superpowers sir.

(Answers may vary)
Okay, based
on your observation class what do you
think are the similarities of the Yes sir
characters in the movies?
Yes, very good! They have a special

ability because they are different from (Answers may vary) Some may say
normal human beings, right? Yes some may say No
Now, the question is, are they real? Or

do they really exist?
Presentation
Before we formally start our new A.) explain how mutations may
discussion this morning, let us check cause changes in structure and
first our objectives. functions of a protein;
Who ca read the first one? B.) distinguish the different types of
mutations, and;
C.) manage issues pertaining to

How about the next one?
persons suffering from genetic
mutation.
How about the last one?
Thank you, class. These objectives will

guide us as we go through with our
discussion.
Lesson Proper
Since, we have identified different

superheroes that all gained some sort Mutation is the process in which the
of special abilities that come from the change in the base sequence of DNA
process mutation. that may affect only one gene, or
they may affect whole chromosomes.
Who can give the definition of
mutation?
Very Good
There are two types of mutation, the Sir the gene mutation is a
gene mutation and the chromosomal permanent change in the DNA
mutation. sequence that makes up a gene.
What is gene mutation? Sir in DNA cytosine is paired
guanine and adenine-is paired
thymine while in RNA is cytosine is
paired guanine and adenine to
Can you still remember the base pairs
uracil.
of our DNA and RNA? what are these?
Yes, very good! Under gene mutation

class, there are two types: point It is a change in one or a few
mutation and frameshift mutation. nucleotides. It includes substitution,
deletion and insertions.
What is Point Mutation? In substitution it occurs when the
nucleotide is replaced with different
nucleotide in the DNA sequence.
Who can differentiate substitution,
In deletion is the removal of a
Deletion and Insertion?
nucleotide from the DNA sequence.
While in insertion is the addition of

a nucleotide to the DNA sequence.
To illustrate the idea of these

mutations. Let’s take a look in this
figure.
Normal DNA THE DOG BIT THE
CAT
Substitution THE DOG BIT TEE
CAT
Insertion THE DOG BIT THE
CAR T
Deletion THE DO_ BIT THE
CAT Shifts the reading of the genetic
message so that the protein may not
Now let us proceed to the second type be able to perform its function. It
of gene mutation which is the also includes insertion and deletion.
Frameshift Mutation.
What is Frameshift Mutation?
To illustrate the idea of these

mutations. Let’s take a look in this
figure.
Normal THE DOG BIT THE CAT
DNA
Insertio THE DOC GBI TTH ECA T

n
Deletion TED OGB ITT HEC AT
There are significance of mutation.

Most are neutral, some are harmful,
but some are beneficial.
None sir
But in some cases, mutation can
caused by mutagens in a form of
medicines, chemicals, radiation,
extremes of temperature, during DNA
replication, and even viral infection. It occurs at the chromosome level
that maybe caused by parts of
Do you have any clarification before
chromosomes breaking off or
we proceed in our next subtopic?
rejoining incorrectly.
Okay, so the second type of mutation
is the chromosomal mutation.
What is Chromosomal Mutation?
The learners will be going to watch

There are also different kinds of the video
chromosomal mutation these are
translocation, deletion and insertion.
So let’s have a figure to visualize what
will happen in this types of mutations.
In translocation the chromosome
Please watch this video and take note swap one or more gene(s) with
of these following questions another chromosome
What is Translocation, Deletion and
Insertion?
What is translocation?
One or more gene(s) are removed
from one chromosome and inserted
into another chromosome.
How about the Insertion?

The single chromosome mutation
involving the loss of one or more
gene(s) from the parent
chromosome.
And how about the deletion?

None sir
Sir some will have a genetic

disorder.
Do you have any questions or

clarifications class?
If that’s so, what do you think class

will be the possible effects when
mutation occurs? No sir
Yes, very good! The gain or loss of

chromosome material can lead to a
variety of genetic disorders. Let us
focus our examples in human.
Are you familiar with Karyotype class?
If that’s so, karyotype are the

homologous pairs of chromosomes are
identified and arranged in order by
size, with the exception of the sex
chromosomes; these appear as shown
in Figure.
So, I have here some examples of
genetic disorders that cause
chromosomal mutation specifically
genetic syndromes.
a. “Cri du chat” is caused by the
deletion of part of the short arm of
chromosome 5. Infants with this
condition often have a high-pitched cry
that sounds like that of a cat.
b. Down’s syndrome is usually caused

by an extra copy of chromosome
21(trisomy 21).
c. Edward’s syndrome, which is the 1. Deletion

second most common trisomy after 2. Translocation
Down’s syndrome, is a trisomy of 3. Duplication
chromosome 18. 4. Down Syndrome
d. Jacobsen syndrome is also called

terminal 11q deletion disorder.
e. Klinefelter’s syndrome (XXY).
f. Turner’s syndrome (X instead of XX or

XY).
Application
Identify what mutation is depicted in

the picture
1. 2.
4.
3.
Mutation is the process in which the

change in the base sequence of DNA
Generalization that may affect only one gene, or
they may affect whole chromosomes.
Based on what we have discussed,
what is Mutation again? The two types of mutation are the
gene mutation and chromosomal
mutation.
What are the two types of mutation? Sir under gene mutation is the point
mutation and frameshift mutation.
Sir under chromosomal mutation is

And what are the two types of gene caused by parts of chromosomes
mutation? breaking off or rejoining incorrectly.
None sir.
What is chromosomal mutation?
Very good, you seem you understood

our lesson.
Do you have any clarifications or

questions?
If that so, once again thank you for

joining this online class and for your
active participation. God bless and
stay safe.
IV. Evaluation
In 1 whole sheet of paper, answer the following questions: (10pts.)
1. If you have a family member with Down syndrome, what will you do?
2. Base on the causes of mutation, how can you prevent your DNA from
mutation?
V. Assignment
A. Follow Up
Create a Slogan or poster on how to promote the rights of people who are
suffering from genetic mutation.
Take Note on the Rubrics

Rubrics: Content – 10
Presentation – 5
Skills - 10
B. Advance
For your assignment, search the following:
1. What are Fossils?
2. Give evidence from Fossil records
3. What is Geological Time Scale?
Alexander, P., Bahret, M.J., Chaves, J., Courts, G., and Naomi Skolky
D'Alessio. Biology: The Living World. Englewood Cliffs, New Jersey: Prentice
Hall, Inc., 1989.

A Detailed Lesson Plan in Science 10: (Genetic Mutation)

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

A Detailed Lesson Plan in Science 10: (Genetic Mutation)

Uploaded by

Copyright:

Available Formats

A Detailed Lesson Plan in

II. Subject Matter:

D. Materials: Powerpoint, Pictures, Learning Module

III. Learning Procedure

Before we start, Diomar can you Place ourselves in the Lord's

For your attendance I will just

Did I give an assignment last meeting?

Okay let’s answer those questions. Yes sir

What was our lesson last meeting?

Class, before we start to our lesson for

Who among from the class are fonds

I have here a picture of movies and I

Teenage Ninja Turtles Sir

They all possessed superpowers sir.

Yes, very good! They have a special

Now, the question is, are they real? Or

C.) manage issues pertaining to

Thank you, class. These objectives will

Since, we have identified different

Yes, very good! Under gene mutation

While in insertion is the addition of

To illustrate the idea of these

What is Frameshift Mutation?

To illustrate the idea of these

Insertio THE DOC GBI TTH ECA T

There are significance of mutation.

What is Chromosomal Mutation?

The learners will be going to watch

How about the Insertion?

And how about the deletion?

Sir some will have a genetic

Do you have any questions or

If that’s so, what do you think class

Yes, very good! The gain or loss of

Are you familiar with Karyotype class?

If that’s so, karyotype are the

b. Down’s syndrome is usually caused

c. Edward’s syndrome, which is the 1. Deletion

d. Jacobsen syndrome is also called

e. Klinefelter’s syndrome (XXY).

f. Turner’s syndrome (X instead of XX or

Identify what mutation is depicted in

Mutation is the process in which the

Sir under chromosomal mutation is

Very good, you seem you understood

Do you have any clarifications or

If that so, once again thank you for

Take Note on the Rubrics

You might also like