DNA Methylation-Mediated Overexpression of CXCL1 in Helicobacter pylori-Induced Gastric Cancer: In Silico- and In Vitro-Based Identification of a Potential Biomarker for Carcinogenesis
Abstract
:1. Introducción
2. Results
2.1. Differentially Expressed Genes (DEGs) Detected from Human Gastric Cancer Tissue Samples and H. pylori-Infected Cells Compared to Normal
2.2. CXCL1 Interacting Proteins and Pathways Analysis
2.3. Detailed Analysis of CXCL1 Expression in TCGA Stomach Adenocarcinoma
2.4. Detailed Analysis of CXCL1 Promoter Methylation in TCGA Stomach Adenocarcinoma
2.5. In Vitro CXCL1 Expression, Promoter Methylation, and Protein Secretion
2.6. CXCL1-Mediated Tumor Microenvironment and Overall Survival in Gastric Cancer Patients
3. Discussion
4. Materials and Methods
4.1. GEO Data Analysis
4.2. In Silico Analysis for Pathway Enrichment, Protein–Protein Interactions, and Correlation
4.3. Cell Lines and Cell Culture
4.4. H. pylori Culture and Treatment
4.5. Demethylation Treatment
4.6. RT-PCR and Methylation-Specific PCR (MSP)
4.7. Enzyme-Linked Immunosorbent Assay (ELISA)
4.8. Western Blotting
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- International Agency for Research on Cancer. Biological agents. IARC Monogr. Eval. Carcinog. Risks Hum. 2012, 100, 1–441. [Google Scholar]
- Muhammad, J.S.; Zaidi, S.F.; Saeed, S.A.; Ishaq, M. Current status of Helicobacter pylori association with haematological and cardiovascular diseases: A mini review. J. Pak. Med. Assoc. 2017, 67, 907–911. [Google Scholar] [PubMed]
- Zaidi, S.F.; Refaat, A.; Zhou, Y.; Sualeh Muhammad, J.; Shin, M.S.; Saiki, I.; Sakurai, H.; Sugiyama, T. Helicobacter pylori Induces Serine Phosphorylation of EGFR via Novel TAK1-p38 Activation Pathway in an HB-EGF-Independent Manner. Helicobacter 2015, 20, 381–389. [Google Scholar] [CrossRef]
- Khoder, G.; Mina, S.; Mahmoud, I.; Muhammad, J.S.; Harati, R.; Burucoa, C. Helicobacter pylori Infection in Tripoli, North Lebanon: Assessment and Risk Factors. Biology 2021, 10, 599. [Google Scholar] [CrossRef]
- White, J.R.; Winter, J.A.; Robinson, K. Differential inflammatory response to Helicobacter pylori infection: Etiology and clinical outcomes. J. Inflamm. Res. 2015, 8, 137–147. [Google Scholar] [CrossRef] [Green Version]
- Deng, R.; Zheng, H.; Cai, H.; Li, M.; Shi, Y.; Ding, S. Effects of helicobacter pylori on tumor microenvironment and immunotherapy responses. Front. Immunol. 2022, 13, 923477. [Google Scholar] [CrossRef]
- Milic, L.; Karamarkovic, A.; Popadic, D.; Sijacki, A.; Grigorov, I.; Milosevic, E.; Cuk, V.; Pesko, P. Altered cytokine expression in Helicobacter pylori infected patients with bleeding duodenal ulcer. BMC Res. Notes 2019, 12, 278. [Google Scholar] [CrossRef] [Green Version]
- Zaidi, S.F.; Muhammad, J.S.; Shahryar, S.; Usmanghani, K.; Gilani, A.H.; Jafri, W.; Sugiyama, T. Anti-inflammatory and cytoprotective effects of selected Pakistani medicinal plants in Helicobacter pylori-infected gastric epithelial cells. J. Ethnopharmacol. 2012, 141, 403–410. [Google Scholar] [CrossRef]
- Lee, H.J.; Song, I.C.; Yun, H.J.; Jo, D.Y.; Kim, S. CXC chemokines and chemokine receptors in gastric cancer: From basic findings towards therapeutic targeting. World J. Gastroenterol. 2014, 20, 1681–1693. [Google Scholar] [CrossRef]
- Do, H.T.T.; Lee, C.H.; Cho, J. Chemokines and their Receptors: Multifaceted Roles in Cancer Progression and Potential Value as Cancer Prognostic Markers. Cancers 2020, 12, 287. [Google Scholar] [CrossRef] [PubMed]
- Cheng, W.L.; Wang, C.S.; Huang, Y.H.; Tsai, M.M.; Liang, Y.; Lin, K.H. Overexpression of CXCL1 and its receptor CXCR2 promote tumor invasion in gastric cancer. Ann. Oncol. 2011, 22, 2267–2276. [Google Scholar] [CrossRef] [PubMed]
- Muhammad, J.S.; Nanjo, S.; Ando, T.; Yamashita, S.; Maekita, T.; Ushijima, T.; Tabuchi, Y.; Sugiyama, T. Autophagy impairment by Helicobacter pylori-induced methylation silencing of MAP1LC3Av1 promotes gastric carcinogenesis. Int. J. Cancer 2017, 140, 2272–2283. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muhammad, J.S.; Eladl, M.A.; Khoder, G. Helicobacter pylori-induced DNA Methylation as an Epigenetic Modulator of Gastric Cancer: Recent Outcomes and Future Direction. Pathogens 2019, 8, 23. [Google Scholar] [CrossRef] [Green Version]
- Lamb, Y.N.; Dhillon, S. Epi proColon((R)) 2.0 CE: A Blood-Based Screening Test for Colorectal Cancer. Mol. Diagn. Ther. 2017, 21, 225–232. [Google Scholar] [CrossRef]
- Machlowska, J.; Baj, J.; Sitarz, M.; Maciejewski, R.; Sitarz, R. Gastric Cancer: Epidemiology, Risk Factors, Classification, Genomic Characteristics and Treatment Strategies. Int. J. Mol. Sci. 2020, 21, 4012. [Google Scholar] [CrossRef]
- Roukos, D.H. Current status and future perspectives in gastric cancer management. Cancer Treat Rev. 2000, 26, 243–255. [Google Scholar] [CrossRef]
- Abi Zamer, B.; Abumustafa, W.; Hamad, M.; Maghazachi, A.A.; Muhammad, J.S. Genetic Mutations and Non-Coding RNA-Based Epigenetic Alterations Mediating the Warburg Effect in Colorectal Carcinogenesis. Biology 2021, 10, 847. [Google Scholar] [CrossRef]
- Vahidi, S.; Mirzajani, E.; Norollahi, S.E.; Aziminezhad, M.; Samadani, A.A. Performance of DNA Methylation on the Molecular Pathogenesis of Helicobacter pylori in Gastric Cancer; targeted therapy approach. J. Pharmacopunct. 2022, 25, 88–100. [Google Scholar] [CrossRef]
- Costa-Pinheiro, P.; Montezuma, D.; Henrique, R.; Jeronimo, C. Diagnostic and prognostic epigenetic biomarkers in cancer. Epigenomics 2015, 7, 1003–1015. [Google Scholar] [CrossRef]
- Frazzi, R.; Zanetti, E.; Pistoni, M.; Tamagnini, I.; Valli, R.; Braglia, L.; Merli, F. Methylation changes of SIRT1, KLF4, DAPK1 and SPG20 in B-lymphocytes derived from follicular and diffuse large B-cell lymphoma. Leuk. Res. 2017, 57, 89–96. [Google Scholar] [CrossRef] [PubMed]
- Cusenza, V.Y.; Braglia, L.; Frazzi, R. Methylation Heterogeneity and Gene Expression of SPG20 in Solid Tumors. Genes 2022, 13, 861. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Jin, R.; Chen, R.; Huang, Z. Complementary action of CXCL1 and CXCL8 in pathogenesis of gastric carcinoma. Int. J. Clin. Exp. Pathol. 2018, 11, 1036–1045. [Google Scholar] [PubMed]
- Zhou, Z.; Xia, G.; Xiang, Z.; Liu, M.; Wei, Z.; Yan, J.; Chen, W.; Zhu, J.; Awasthi, N.; Sun, X.; et al. A C-X-C Chemokine Receptor Type 2-Dominated Cross-talk between Tumor Cells and Macrophages Drives Gastric Cancer Metastasis. Clin. Cancer Res. 2019, 25, 3317–3328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miyake, M.; Lawton, A.; Goodison, S.; Urquidi, V.; Gomes-Giacoia, E.; Zhang, G.; Ross, S.; Kim, J.; Rosser, C.J. Chemokine (C-X-C) ligand 1 (CXCL1) protein expression is increased in aggressive bladder cancers. BMC Cancer 2013, 13, 322. [Google Scholar] [CrossRef] [Green Version]
- Cao, Z.; Fu, B.; Deng, B.; Zeng, Y.; Wan, X.; Qu, L. Overexpression of Chemokine (C-X-C) ligand 1 (CXCL1) associated with tumor progression and poor prognosis in hepatocellular carcinoma. Cancer Cell Int. 2014, 14, 86. [Google Scholar] [CrossRef] [Green Version]
- Miyake, M.; Furuya, H.; Onishi, S.; Hokutan, K.; Anai, S.; Chan, O.; Shi, S.; Fujimoto, K.; Goodison, S.; Cai, W.; et al. Monoclonal Antibody against CXCL1 (HL2401) as a Novel Agent in Suppressing IL6 Expression and Tumoral Growth. Theranostics 2019, 9, 853–867. [Google Scholar] [CrossRef]
- Lim, S.Y.; Yuzhalin, A.E.; Gordon-Weeks, A.N.; Muschel, R.J. Tumor-infiltrating monocytes/macrophages promote tumor invasion and migration by upregulating S100A8 and S100A9 expression in cancer cells. Oncogene 2016, 35, 5735–5745. [Google Scholar] [CrossRef] [Green Version]
- Zhuo, C.; Wu, X.; Li, J.; Hu, D.; Jian, J.; Chen, C.; Zheng, X.; Yang, C. Chemokine (C-X-C motif) ligand 1 is associated with tumor progression and poor prognosis in patients with colorectal cancer. Biosci. Rep. 2018, 38, BSR20180580. [Google Scholar] [CrossRef] [Green Version]
- Acharyya, S.; Oskarsson, T.; Vanharanta, S.; Malladi, S.; Kim, J.; Morris, P.G.; Manova-Todorova, K.; Leversha, M.; Hogg, N.; Seshan, V.E.; et al. A CXCL1 paracrine network links cancer chemoresistance and metastasis. Cell 2012, 150, 165–178. [Google Scholar] [CrossRef] [Green Version]
- Lee, C.W.; Chiang, Y.C.; Yu, P.A.; Peng, K.T.; Chi, M.C.; Lee, M.H.; Fang, M.L.; Lee, K.H.; Hsu, L.F.; Liu, J.F. A Role of CXCL1 Drives Osteosarcoma Lung Metastasis via VCAM-1 Production. Front. Oncol. 2021, 11, 735277. [Google Scholar] [CrossRef] [PubMed]
- Miyake, M.; Lawton, A.; Goodison, S.; Urquidi, V.; Rosser, C.J. Chemokine (C-X-C motif) ligand 1 (CXCL1) protein expression is increased in high-grade prostate cancer. Pathol. Res. Pract. 2014, 210, 74–78. [Google Scholar] [CrossRef] [PubMed]
- Casasanta, M.A.; Yoo, C.C.; Udayasuryan, B.; Sanders, B.E.; Umana, A.; Zhang, Y.; Peng, H.; Duncan, A.J.; Wang, Y.; Li, L.; et al. Fusobacterium nucleatum host-cell binding and invasion induces IL-8 and CXCL1 secretion that drives colorectal cancer cell migration. Sci. Signal. 2020, 13, eaba9157. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Liu, W.; Zheng, Y.; Wang, S.; Yang, B.; Li, M.; Song, J.; Zhang, F.; Zhang, X.; Wang, Q.; et al. CXCL1 derived from tumor-associated macrophages promotes breast cancer metastasis via activating NF-kappaB/SOX4 signaling. Cell Death Dis. 2018, 9, 880. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Zhou, B.; Pache, L.; Chang, M.; Khodabakhshi, A.H.; Tanaseichuk, O.; Benner, C.; Chanda, S.K. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 2019, 10, 1523. [Google Scholar] [CrossRef]
- Muhammad, J.S.; Guimei, M.; Jayakumar, M.N.; Shafarin, J.; Janeeh, A.S.; AbuJabal, R.; Eladl, M.A.; Ranade, A.V.; Ali, A.; Hamad, M. Estrogen-induced hypomethylation and overexpression of YAP1 facilitate breast cancer cell growth and survival. Neoplasia 2021, 23, 68–79. [Google Scholar] [CrossRef]
(A) | ||||||
---|---|---|---|---|---|---|
Gene | F/R | Sequence (5’ > 3’) | Tm (°C) | Product (bp) | ||
CXCL1 | F R | GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG | 65.2 64.8 | 70 | ||
GAPDH | F R | CCAGAACATCATCCCTGCCT CCTGCTTCACCACCTTCTTG | 62.4 60.8 | 185 | ||
(B) | ||||||
Gene | F/R | M/U | Sequence (5’ > 3’) | Tm (°C) | Product (bp) | |
CXCL1 | F R | M | TTAATTATGTATAAAAGGGGTTCGC TAAAACTCAACAAACGAATCTAACG | 58.9 58.9 | 119 | |
CXCL1 | F R | U | TAATTATGTATAAAAGGGGTTTGTGG AAACTCAACAAACAAATCTAACAAC | 51.0 54.1 | 116 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Muhammad, J.S.; Manzoor, S.; Cui, Z.-G.; Khoder, G. DNA Methylation-Mediated Overexpression of CXCL1 in Helicobacter pylori-Induced Gastric Cancer: In Silico- and In Vitro-Based Identification of a Potential Biomarker for Carcinogenesis. Int. J. Mol. Sci. 2023, 24, 795. https://doi.org/10.3390/ijms24010795
Muhammad JS, Manzoor S, Cui Z-G, Khoder G. DNA Methylation-Mediated Overexpression of CXCL1 in Helicobacter pylori-Induced Gastric Cancer: In Silico- and In Vitro-Based Identification of a Potential Biomarker for Carcinogenesis. International Journal of Molecular Sciences. 2023; 24(1):795. https://doi.org/10.3390/ijms24010795
Chicago/Turabian StyleMuhammad, Jibran Sualeh, Shaista Manzoor, Zheng-Guo Cui, and Ghalia Khoder. 2023. "DNA Methylation-Mediated Overexpression of CXCL1 in Helicobacter pylori-Induced Gastric Cancer: In Silico- and In Vitro-Based Identification of a Potential Biomarker for Carcinogenesis" International Journal of Molecular Sciences 24, no. 1: 795. https://doi.org/10.3390/ijms24010795