Next Article in Journal
Effect of a Monoglyceride Blend in Nile Tilapia Growth Performance, Immunity, Gut Microbiota, and Resistance to Challenge against Streptoccocosis and Francisellosis
Previous Article in Journal
A Study on the Automation of Fish Species Recognition and Body Length Measurement System
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 9
Issue 9
10.3390/fishes9090350
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transcriptomic Analysis Provides Insights into the Energetic Metabolism and Immune Responses in Litopenaeus vannamei Challenged by Photobacterium damselae subsp. damselae

by
Libao Wang
1,
Qiuwen Xu
2,
Zhijun Yu
1,3,
Zhenxin Hu
4,
Hui Li
1,
Wenjun Shi
1 and
Xihe Wan
1,*
1
Institute of Oceanology & Marine Fisheries, Nantong 226007, China
2
Tongzhou District Agriculture and Forestry Science and Education Management Station, Nantong 226300, China
3
National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, Shanghai 201306, China
4
Qidong Fishery Technology Promotion Station, Nantong 226200, China
*
Author to whom correspondence should be addressed.
Fishes 2024, 9(9), 350; https://doi.org/10.3390/fishes9090350
Submission received: 29 July 2024 / Revised: 4 September 2024 / Accepted: 4 September 2024 / Published: 6 September 2024
Browse Figures
Versions Notes

Abstract

:
To explore the molecular mechanisms of the Litopenaeus vannamei response to infection by Photobacterium damselae, reveal its immune response and energetic metabolic effect, and provide a valuable genetic data source for the scientific prevention and control of Vibrio infection, transcriptomic analysis, RT-qPCR, and physiological and biochemical tests were conducted. The results showed that the expression of key genes involved in lipid and carbohydrate transport, such as apolipoprotein and TPS, was upregulated after pathogenic infection, which brought the accumulation of triacylglycerol and trehalose into the hemolymph. Additionally, the pathogenic infection selectively triggered an immune response in infected L. vannamei, activating certain immune pathways, such as the serpins and MAPK pathways. The pathogenic infection suppressed the activity of phenoloxidase (PO), and the prophenoloxidase (PPO) cascade responses were suppressed by the invasive bacteria. This paper will help us understand the energetic metabolism, immune response, and activation of the immune recognition response after pathogenic infection by P. damselae, and it lays a theoretical foundation for the biological prevention and control of P. damselae infection.
Keywords:
bacterial infection; transcriptomic analysis; RT-qPCR; physiological and biochemical tests; selective reinforcement
Key Contribution: Transcriptomic analysis, RT-qPCR, and physiological and biochemical tests showed the immune response and energetic metabolic interactions after pathogenic infection. The infection selectively enhanced energetic metabolism and the immune response accordingly.

Graphical Abstract

1. Introduction

Bacterial and viral diseases are the major issues in pond cultures of Litopenaeus vannamei in Asia and Latin America [1]. In the past decade, they have caused serious economic losses of approximately USD 1 billion annually [2,3]. Additionally, vibriosis is the most common disease impacting shrimp farming [4]. According to reports, many Vibrio species can infect shrimp, including V. harveyi [5,6], V. alginolyticus [7], V. parahaemolyticus [8], V. campbellii [9,10], V. nigripulchritudo [11,12], and V. penaecida [13,14]. Vibrio act as opportunistic or secondary pathogens for shrimp under stress [15].
Photobacterium was initially described as Gram-negative Vibrio bacteria with motile rods and as facultative aerobic bacteria [16]. This genus exists in various aquatic ecosystems, including seawater, marine sediments, saline lakes, and different marine organisms, and these establish different relationships from symbiosis to pathogenic interactions [17,18,19]. This genus contains 33 species and 2 subspecies with valid names [20]. Originally, all species of this genus were considered luminescent, including six species of Photobacterium that are actually luminescent, such as P. phosphoreum, P. leiognathi, P. aquimaris, P. angustum, P. ganghwense, and P. kishitanii [18,21,22]. Both luminous and non-luminous species can grow not only in general media but also in the selective media TCBS, which is commonly used to isolate vibrios [19]. P. damselae has rarely been reported to infect shrimp as a gram-negative vibrio [23,24]. Previous studies have indicated that the main clinical characteristics of bacteria-infected shrimp were weakened vitality of the diseased shrimp, atrophic and white hepatopancreas, jejunum, and empty stomach. Meanwhile, the physicochemical characteristics and drug sensitivity of the bacteria have been analyzed. However, the study on the mechanism between P. damselae (V. damselae) and shrimp is still lacking, especially regarding the molecular mechanism of immune responses in L. vannamei challenged by P. damselae as this has not been deeply analyzed. There is a hypothesis that challenge by P. damselae can upregulate the expression of critical genes and enzymes connected with energetic metabolism (including carbohydrate, lipid, and protein metabolism), trigger immune actions, and, in particular, strengthen the roles of certain immune effectors.
To validate the hypothesis on immune responses and energetic metabolism in L. vannamei after infection, samples from shrimp artificially infected with P. damselae were collected for further analysis. We analyzed the responds of L. vannamei after infection using transcriptomic analysis and then verified the results with RT-qPCR. Triacylglycerol (TAG) and trehalose concentration, the activities of trehalose-6-phosphate synthase (TPS), phenoloxidase (PO), lysozyme, catalase (CAT), and glutathione peroxidase (GSH-PX) in hemolymph samples of infected shrimp were analyzed to investigate the variations in energetic metabolism and immune responses after infection. This paper will inform us on the mechanism of infection between P. damselae and shrimp and provide a scientific basis for the prevention and control of this pathogen.

2. Materials and Methods

2.1. Animals and Bacterial Infection

Healthy shrimp (L. vannamei) were collected from the Rudong Base of Jiangsu Institute of Oceanology and Marine Fisheries. The P. damselae strain MRY0520 used for the artificial challenge was preserved in our laboratory. One week before the experiment, the shrimp were acclimatized in filtered and aerated seawater at a constant temperature of 25 ± 1 °C and a salinity of 8‰, and they were fed twice with commercialized feed. Water was changed once a day, and the residual feed and feces were promptly removed. Two treatment groups (NS and DS) were set up with triplicates per treatment. A total of 120 shrimp (weight of 8.5~9.5 g) were randomly distributed into six plastic aquariums (50 L, with randomly assigned 20 individuals/aquarium). The shrimp in the DS group were injected with 20 μL of P. damselae, which was suspended in physiological saline with a concentration of 9.68 × 107 CFU/mL (2.15 × 105 CFU/g). Meanwhile, the shrimp in the NS group, as the control group, were injected with an equal volume of sterilized physiological saline. At 24 h after infection, 18 shrimp were taken from each group, respectively, and the hepatopancreas from 6 shrimp were taken as a mixed sample, which was prepared for transcriptome sequencing. At the same time, hemolymph samples from each treatment group were extracted for the determination of the physiological and biochemical indicators [25]. The hepatopancreas tissues of the shrimp were dissected and immediately frozen in liquid nitrogen before being stored at −80 °C until RNA extraction (Figure 1).

2.2. RNA Extraction, Library Construction, and Sequencing

For the library construction, the total RNA from the three independent biological replicates in each treatment group was collected together and extracted using a Trizol reagent kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The integrity of the total RNA was evaluated by RNase-free agarose gel electrophoresis, and the concentration of RNA was measured by a BioPhotometer Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). After the total RNA was extracted, the eukaryotic mRNA was enriched by oligo (dT) beads. Then, the enriched mRNA was fragmented into short fragments using a fragmentation buffer and reversely transcribed into cDNA by using an NEBNext® Ultra RNA Library Prep Kit for Illumina (NEB #7530, New England Biolabs, Ipswich, MA, USA). The purified double-stranded cDNA fragments were end-repaired, and a base was added and ligated to the Illumina sequencing adapters. The ligation reaction was purified with AMPure XP Beads (1.0×). The ligated fragments were subjected to size selection by agarose gel electrophoresis and an amplified polymerase chain reaction (PCR). The resulting cDNA library was sequenced using an Illumina Novaseq6000 from Gene Denovo Biotechnology Co. (Guangzhou, China).

2.3. Data Assembly and Functional Annotation

The raw reads were filtered using Fastp (Version: 0.23.4) [26], and the non-shrimp sequences were eliminated. We kept the clean reads sequences for the next step, and they were assembled and used to calculate the transcript abundance. We set the L. vannamei genome (NCBI no. GCF_003789085.1) as a reference genome [27]. All the unigenes were annotated against four common databases, including the Nr, Swiss-prot, KEGG, and GO databases [28]. The value of the FPKM (fragment per kilobase per million mapped reads in transcription) was selected as the key indicator for the unigene evaluation and screening of the differentially expressed genes (DEGs) [29,30]. The DEGs significance was further confirmed with the classic method [31]. To assess the potential functions of the infected shrimp unigenes, all of the unigenes were annotated with the Annotation System (KOBAS) (Version: 3.0.3) online service [32,33,34]. DEGs in the different treatment groups were subjected to KEGG software (Version: 4.20.) automatically using a cut-off E value of 10−10. Then, the enriched pathways were screened within the threshold ranges of a p-value of <0.001 and an FDR of <0.05. TBtools (Version: 5.3.2) was used to conduct the two-dimensional (2D) hierarchical cluster analysis [35].

2.4. RT-qPCR Analysis

Eight annotated and candidate DEGs related to energetic metabolism and immune response were purposefully selected and analyzed by RT-qPCR to further validate the reliability of the transcriptome sequencing. The RT-qPCR was conducted in a 20 μL reaction mixture system according to the same reaction conditions as our laboratory’s method [36]. Specific primers were designed with Primer 5.0 software as shown in Table 1, and then they were sent to Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China) for synthesis. The RT-qPCR validation experiment used a TaKaRa relative fluorescence quantification kit, with β actin as the internal reference gene [37]. Biological triplicates from three independent experiments of all samples were conducted after infection. The relative expression of the target gene was calculated with 2−ΔΔCt to confirm the expression levels of the target DEGs [38].

2.5. Measurement of TAG and Trehalose Concentrations in the Hemolymph Samples of the Infected Shrimp

As mentioned above, hemolymph samples were collected according to the method of Nadala et al. [25]. Five infected shrimp were randomly selected from each experimental group, and then a 1 mL sterile syringe was used to collect hemolymph from the pericardial cavity. After being stored at 4 °C for 16 h, the samples were centrifuged at 8000 rpm for 5 min at 4 °C. The supernatants were taken and stored in a −80 °C freezer for measuring the hemolymph biochemical indicators and enzyme activity. At the same time, 5 uninfected shrimp were randomly selected for hemolymph collection using the same method abovementioned and set as the control group. To measure the triacylglycerol (TAG) and trehalose concentrations in the hemolymph samples of the infected shrimp, 150 µL µL of diluted hemolymph samples with double-distilled water were collected to be measured with the corresponding assay kit (Solarbio company, Beijing, China) following the manufacturer’s protocol.

2.6. Measurement of the Activities of PO, TPS, Lysozyme, CAT, and GSH-PX in the Infected Shrimp

The activities of PO, TPS, and lysozyme in the hemolymph samples of the infected shrimp were determined according to the methods already published by our research group [39].
For catalase (CAT) activity determination, we prepared the test hemolymph supernatant and put it into a test solution at a ratio of 1:99, then we let it stand for 10 min and prepared the corresponding reaction solution according to the reaction system specified in the product manual (Jiancheng Company, Nanjing, China). After the above reaction was completed, we mixed the reaction systems of each tube evenly, adjusted them to zero with double-distilled water at 405 nm, measured the absorbance values of each tube, and calculated the corresponding CAT activity based on the changes in the absorbance values at 405 nm.
For glutathione peroxidase (GSH-PX) activity determination, we prepared the solution system for the first-step enzymatic reaction and the solution system for the second-step colorimetric reaction according to the product manual (Jiancheng Company, Nanjing, China), and we conducted the enzymatic and colorimetric reactions according to the temperature and time requirements specified in the manual. After the colorimetric reaction was completed, the above reaction solution was mixed well and allowed to stand at room temperature for 15 min. Then, a 1 cm colorimetric dish was used at 412 nm for the colorimetry, and the OD values of each tube were measured using double-distilled water. Finally, the activity of GSH-PX was calculated based on the consumption of the reduced glutathione in the enzymatic reaction.

2.7. Assay of the Protein Concentration

The protein concentrations in the hemolymph samples were determined and analyzed with the Bradford method [40] using standard protein curves to calibrate the protein concentration results.

2.8. Data Analysis

One-way analysis of variance (ANOVA) was used to analyze the results according to the Tukey post-test [41], and then the results were plotted with GraphPad Prism 8.0 (GraphPad Software, Inc., San Diego, CA, USA). P-values were used to identify the statistical significance of the result differences (*, p < 0.05; **, p < 0.01; and ***, p < 0.001).

3. Results

3.1. Illumina Sequencing and Quality Assessment

To analyze the relationship among the immune responses, energetic metabolism, and biological behavior in the L. vannamei that were infected by P. damselae, RNA sequencing on libraries from various treatment groups was conducted to analyze their transcriptomic differences. After filtering the original sequencing data, 222,611,760 high-quality reads were obtained. The base number in the control group was 16,615,746,031 bp, and the number of high-quality reads was 111,248,776. The base number in the infection group was 16,510,807,428 bp, and the number of high-quality reads was 111,362,984. The Q30 value of the six transcripts nearly reached 90%. The clean reads of the six transcripts were compared with the designated reference genome, and the comparison efficiency was 86.2~88.5%. At the same time, the percentages of these libraries were similar to each other (Table 2). The mean of the total mapped ratio for the six groups exceeded 85%, which met the preliminary requirements of transcriptomic analysis [42].

3.2. Annotation Analysis of the New Gene Function and Analysis of the DEGs

In this paper, 1,693 new genes were discovered, and their functions were annotated using the Nr, KEGG, and GO databases. Through comparison, 1196 new genes were annotated (Table 3). Among them, 595 new genes were annotated in the GO database, accounting for 49.8%. The proportion of new genes annotated in the KEGG database was the least, approximately 17.9%.
To investigate the regulation patterns of the important functional genes in P. damselae infection, DEGs were screened from the mentioned libraries, and they exceeded at least two-fold changes, with a p-value of <0.005. In the hepatopancreas, a total of 1521 differential expression genes were induced by P. damselae infection, with 763 and 758 genes up- and down-regulated, respectively (Figure 2). The duplicate DEGs were removed, and then the clustering analysis was performed on all DEGs using TBtools (Figure 3). The DEGs were clustered into six groups, with most clustered in assemblages two, four, and five. In assemblage two, most of the DEGs related to immune response were found to be upregulated at the transcriptional level. In contrast, in assemblages four and five, the DEGs related to energetic metabolism and other metabolic pathways were downregulated at the transcriptional level.

3.3. Transcriptomic Analysis Revealed That the Infection Selectively Strengthened the Expression of Energetic Metabolism- and Immune Response-Related Genes

To investigate the expression levels of energetic metabolism- and immune response-related genes in the infected shrimp, further analysis was conducted by creating a hierarchical cluster after the completion of the GO and KEGG enrichment analysis (Figure 4). The transcriptome data analysis results showed that the expression of minor genes related to lipid transport and key carbohydrate synthesis showed significant upregulation, such as APO and TPS. On the other hand, a majority of the other genes related to lipid metabolism, carbohydrate metabolism, and amino acid metabolism showed significant downregulation, such as SLC37A4, Mttp, and Lipl-1 (Figure 4A).
The expression levels of some pattern-recognition receptors (PRRs) were clearly up-regulated after infection in the infected shrimp, such as Toll protein (Toll) and Integrin (MYS), but C-type lectin (CTL) was downregulated in the infected shrimp. Moreover, the expression levels of other PRRs were inhibited conversely, such as beta-1,3-glucan-binding protein precursor (Vtg1, MTTP, and bGRP). Lysozyme as the immune effector was unexpectedly significantly inhibited after infection. Similar results were observed in the expression levels of genes related to key immune indicators such as catalase (CAT) and glutathione peroxidase (GPX). In this study, superoxide dismutase (SOD) and PPO were inhibited after infection, indicating that the reactive oxygen species (ROS) levels may have been strengthened. The expression of mitogen-activated protein kinase (MAPK) was significantly upregulated after infection. The results indicated that infection activated the MAPK pathway, which affects innate immune responses to various pathogenic organisms including fungi, viruses, and bacteria (Figure 4B).

3.4. qPCR Analysis of the Energetic Metabolism- and Immune Response-Related Genes in the Infected L. vannamei

To further validate the reliability of the transcriptome sequencing after infection, eight annotated and candidate DEGs related to immune response and energetic metabolism were purposefully selected and analyzed by RT-qPCR (Figure 5). The results showed that the expression of genes related to lipid transport and triglyceride metabolism (APO and TPS) was clearly upregulated after infection (Figure 5A,B), while in contrast, the expression of Mttp and Lipl was inhibited (Figure 5C,D). At the same time, the expression of genes associated with immune response (Serpin2 and MAPK) was clearly upregulated after infection (Figure 5E,F), while the expression of GPX and CAT was inhibited (Figure 5G,H). The above qPCR detection test results were highly consistent with the transcriptome analysis results after infection. Infection with P. damselae selectively enhanced the energetic metabolism and immunity statuses of the infected L. vannamei.

3.5. The Variations in TAG and Trehalose Concentrations and Activities of PO, TPS, Lysozyme, CAT, and GSH-PX in the Infected L. vannamei Hemolymph Samples

To further analyze the effects of infection by P. damselae on the physiological activities and behaviors of L. vannamei, we measured the concentrations of triacylglycerols (TAG) and trehalose in the hemolymph samples of the infected L. vannamei, as well as the enzyme activities of PO, trehalose-6-phosphate synthase (TPS), lysozyme, catalase (CAT), and glutathione peroxidase (GSH-PX). The results showed that the TAG concentration increased by 138.1% after infection compared to the control group (Figure 6A). This result suggested that the triacylglycerols stored in the fat bodies were likely to be transported to the hemolymph for further utilization, and this was also consistent with the high expression of triacylglycerol transport-related genes in the transcriptome analysis. At the same time, the significant increase in fucose concentration in the hemolymph was also consistent with the high expression of the TPS gene (Figure 6B). Additionally, the PO activity in the hemolymph samples of the infected L. vannamei was reduced to 60.7% in comparison to the control group (Figure 6C), which was consistent with the high expression of PPO in the transcriptome analysis. The significant increases in the activities of TPS in the hemolymph samples of the infected shrimp also explained the increases in trehalose concentrations in their hemolymph samples from another perspective (Figure 6D). After infection, the activities of lysozyme, CAT, and GSH-PX in the hemolymph samples of the control group were 60.8%, 71.7%, and 75.1%, respectively (Figure 6E–G). The downward trend of the above three enzymes was highly consistent with the transcriptome analysis results after infection.

4. Discussion

4.1. The Effect of Pathogen Infection on the Energetic Metabolism of L. vannamei

Infection by bacteria can reallocate the nutritional and energy resources of infected farmed crustaceans, which can alter their immunity and other physiological behaviors [43,44]. This study found that the infected L. vannamei had selectively enhanced energetic metabolism and immune responses, which were connected with multifunctional processes including antistress and immune responses. Analyzing the physiological behaviors of the infected shrimp helped in analyzing the interactions between the pathogens and the infected individuals’ energy and immune homeostasis.
As is well known, vibriosis can cause significant economic losses to the aquaculture industry, and Vibrio is the most commonly reported bacterium associated with pathogens in shrimp and marine fish [45,46]. Pathogenic or opportunistic Vibrio infection can be devasting, especially during the crustacean seedling production stage [47,48]. Thus, notwithstanding the importance of Vibrio as an opportunistic pathogen, little is known about its effects on shrimp metabolism, and this knowledge is essential for the production of antivibrio strategies. As has been reported in the literature on vibrio infection, the invasion behaviors of pathogens have evolved the ability to alter different metabolic pathways of a host to achieve successful replication within the host’s body [49]. Several studies on vertebrates have shown that the expression of some genes encoding metabolic enzymes are upregulated significantly during a pathogenic infectious process [50,51]. Nevertheless, little is known about the specific molecular mechanisms affecting the metabolism of key enzymes involved in energetic metabolism in shrimp species by vibrio pathogens. TAG is one of the most important lipid storage substances used for energetic metabolism in shrimp, and it constitutes approximately 18.0% of the total wet weight of the hepatopancreas in juvenile L. vannamei. Meanwhile, fluctuations in lipids, especially TAG concentrations, may affect the susceptibility of larval and post-larval shrimp to pathogenic infections [52]. In this study, both the transcriptome and qPCR experiments showed that in L. vannamei infected with P. damselae, the expression of apolipoprotein showed a significant upregulation and the TAG concentrations in the hemolymph samples increased significantly compared to the control group (Figure 4A, Figure 5A and Figure 6A). However, it is still unclear how TAG concentrations impact the susceptibility of L. vannamei infected with P. damselae, as are the specific molecular regulatory mechanisms of energetic metabolism during infection. In addition, trehalose as the main form of carbohydrate transport in arthropods participates in energy storage and metabolic activities [53,54,55]. At the same time, it significantly contributes to the stress tolerance of crustaceans, which protects proteins and membranes from damage, especially during dehydration/rehydration processes [56,57]. Additionally, its presence enhances the expression of some immune-related genes, improving a host’s resistance to pathogen infection [58]. Our results showed that when L. vannamei were infected by P. damselae, the expression of TPS was significantly upregulated and the trehalose concentration in the hemolymph showed a significant upward trend (Figure 5B and Figure 6B). The expression levels of immune-related genes in L. vannamei were selectively enhanced after infection with P. damselae (Figure 4B).

4.2. The Effect of Pathogen Infection on the Immune Responses of L. vannamei

Shrimp do not have an adaptive immune system; their defense is believed to rely entirely on an innate, non-adaptive mechanism to resist pathogen invasion [59], and inoculation with viral vaccines is ineffective [58]. The first line of defense against microbial infections is the innate immune response, which triggers various humoral and cellular activities through signal transduction pathways [60]. Hemocyanin (Hc) is a copper-containing respiratory protein in some invertebrates such as mollusks (cephalopods) and arthropods (shrimp and crab) [61]. As a respiratory protein, the biological function of hemocyanin is mainly to bind oxygen molecules and deliver oxygen to the body. In addition, hemocyanin is also related to many functions such as immune function and protein storage [62]. It was reported that the relative expression of hemocyanin in L. vannamei was high at the initial stage of V. parahaemolyticus infection, and it significantly decreased 12 h later [63]. In this paper, the hepatopancreas transcriptome profiles of L. vannamei infected with P. damselae showed that the hemocyanin gene was significantly downregulated in the DS group (Figure 4B). It was thought that P. damselae could inhibit the production of hemocyanin by inducing the downregulation of the hemocyanin gene, leading to hypoxia and a reduction in the stored protein in the body, thereby affecting the physiological activities of the shrimp and causing decreased vitality and food intake.
The PPO system is reported to be crucial in the innate immune defense against pathogenic bacteria and fungi in crustaceans [64,65]. Furthermore, the recognition of pathogen cell-wall components by pattern-recognition proteins (PRPs) is a critical step in the activation of the melanization cascade. Recent evidence from a study on insects has indicated that certain serine proteinases (SPs) act as PRPs and are required for the activation of the melanization cascade to recognize pathogens [66]. Meanwhile, it was reported that apolipoprotein III is a PRR in charge of lipid transportation and immune-response-triggering in insects [67,68,69], which occupies a pivotal position in the PPO activating system (PPO-AS) in humoral immunity. In our study, the APO up-regulation after infection by P. damselae might have indicated that an immune recognition response was triggered by the pathogenic bacteria infection (Figure 4A and Figure 5A). However, the PP0 down-regulation and PO activity were inhibited after the PO activity was inhibited after pathogenic infection (Figure 4A and Figure 6C), indicating that the reactive oxygen species (ROS) levels may have been weakened. The MAPK pathway affects innate immune responses, which are used to defend the various pathogenic organisms including fungi, viruses, and bacteria. In our study, the expression levels of MAPK were clearly upregulated after the infection by pathogenic bacteria (Figure 4B and Figure 5F). It is still unknown how the PRPs activate the PPO system, and this requires further investigation. High homocysteine (Hcy) concentrations can increase the production of ROS in cells. ROS are important second messengers in cells, and they mediate the production of inflammatory cytokines and help to eliminate pathogens [70]. Betaine homocysteine methyltransferase (Bhmt) is a promoter of Hcy methylation to methionine (Met), reducing the function of Bhmt and improving the level of Hcy [71,72]. In this study, the downregulation of Bhmt gene expression in the DS group (Figure 3A) contributed to the accumulation of homocysteine to promote the production of ROS, thereby eliminating pathogenic microorganisms.
Heat shock proteins (HSPs) are the factors that regulate immune system responses during mammalian infections [73]. HSPs are a protein superfamily found in insects, and this family includes ATP-independent HSP and ATP-dependent HSP, which regulate protein folding and protect cells from stress [74]. With the deepening of research, the presence of HSP has been found to successfully activate various immune pathways such as JAK/STAT in insects such as Galleria mellonella and Antheraea pernyi, triggering immune responses to invading pathogens [75,76]. The main immune pathway of crustaceans to external pathogenic microorganisms is innate immunity. In conducting transcriptome and morphological analyses on the changes in the intestinal barrier of L. vannamei after an attack by V. parahaemolyticus, it was found that HSP is related to the function of the shrimp immune barrier, and the HSP gene was upregulated [77]. The same upregulation of HSP expression was found in an infection by V. parahaemolyticus through an analysis of the hepatopancreas transcriptome of Macrobrachium rosenbergii [78]. The results of this study were consistent in that HSP gene expression was also significantly up-regulated in the DS group (Figure 4B), indicating that HSP plays an important role in mediating the immune response of L. vannamei to a challenge by P. damselae.

5. Conclusions

Through transcriptomic analysis, RT-qCR, and physiological and biochemical tests, this study revealed changes in energy metabolism and immune responses of L. vannamei infected with P. damselae. The results showed that the expression of crucial genes related to lipid and carbohydrate transport, such as apolipoprotein and TPS, were upregulated after pathogenic infection, which led to the accumulation of triacylglycerol and trehalose in the hemolymph. Additionally, the infection selectively activated the immune response in infected L. vannamei, enhancing certain immune pathways, such as the serpins and MAPK pathways. However, phenoloxidase (PO) activity was suppressed due to the pathogenic infection, and the PPO cascade responses were inhibited by the invasive bacteria. The changes in energetic metabolism and immune response ability positively contributed to shrimp resistance to pathogenic invasion.

Author Contributions

Data curation, L.W., H.L. and W.S.; formal analysis, L.W.; funding acquisition, X.W.; investigation, Q.X., Z.H. and W.S.; project administration, X.W.; supervision, X.W.; writing—original draft, Q.X. and Z.Y.; writing—review and editing, L.W. and X.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Earmarked Fund for Jiangsu Agricultural Industry Technology System (JATS[2023]380) and the Jiangsu Seed Industry Revitalization Project (JBGS[2021]122).

Institutional Review Board Statement

All samples and methods used in the present study were conducted in accordance with the Laboratory Animal Management Principles of China. All experimental protocols were approved by The Laboratory Animal Ethic Committee of the Jiangsu Institute of Marine Fisheries (Animal Ethics no. 2022-3-1). All shrimp handling was performed under ice anesthesia.

Data Availability Statement

The data presented in this study are available from the first author. Data are contained within the article.

Conflicts of Interest

The authors all declare that they have no conflicts of interest.

References

  1. Alfiansah, Y.R.; Peters, S.; Harder, J.; Hassenrück, C.; Gärdes, A. Structure and co-occurrence patterns of bacterial communities associated with white faeces disease outbreaks in Pacific white-leg shrimp Penaeus vannamei aquaculture. Sci. Rep. 2020, 10, 11980. [Google Scholar] [CrossRef] [PubMed]
  2. De Schryver, P.; Defoirdt, T.; Sorgeloos, P. Early mortality syndrome outbreaks: A microbial management issue in shrimp farming? PLoS Pathog. 2014, 10, e1003919. [Google Scholar] [CrossRef] [PubMed]
  3. Soto-Rodriguez, S.A.; Gomez-Gil, B.; Lozano-Olvera, R.; Betancourt-Lozano, M.; Morales-Covarrubias, M.S. Field and experimental evidence of Vibrio parahaemolyticus as the causative agent of acute hepatopancreatic necrosis disease of cultured shrimp (Litopenaeus vannamei) in Northwestern Mexico. Appl. Environ. Microbiol. 2015, 81, 1689–1699. [Google Scholar] [CrossRef]
  4. Defoirdt, T.; Boon, N.; Sorgeloos, P.; Verstraete, W.; Bossier, P. Alternatives to antibiotics to control bacterial infections: Luminescent vibriosis in aquaculture as an example. Trends Biotechnol. 2007, 25, 472–479. [Google Scholar] [CrossRef]
  5. Rungrassamee, W.; Klanchui, A.; Maibunkaew, S.; Karoonuthaisiri, N. Bacterial dynamics in intestines of the black tiger shrimp and the Pacific white shrimp during Vibrio harveyi exposure. J. Invertebr. Pathol. 2016, 133, 12–19. [Google Scholar] [CrossRef] [PubMed]
  6. Zhang, X.H.; He, X.; Austin, B. Vibrio harveyi: A serious pathogen of fish and invertebrates in mariculture. Mar. Life Sci. Technol. 2020, 2, 231–245. [Google Scholar] [CrossRef] [PubMed]
  7. Yin, X.; Zhuang, X.; Liao, M.; Huang, L.; Cui, Q.; Liu, C.; Dong, W.; Wang, F.; Liu, Y.; Wang, W. Transcriptome analysis of Pacific white shrimp (Litopenaeus vannamei) hepatopancreas challenged by Vibrio alginolyticus reveals lipid metabolic disturbance. Fish Shellfish Immunol. 2022, 123, 238–247. [Google Scholar] [CrossRef]
  8. Li, L.; Meng, H.; Gu, D.; Li, Y.; Jia, M. Molecular mechanisms of Vibrio parahaemolyticus pathogenesis. Microbiol. Res. 2019, 222, 43–51. [Google Scholar] [CrossRef]
  9. Dong, X.; Wang, H.; Xie, G.; Zou, P.; Guo, C.; Liang, Y.; Huang, J. An isolate of Vibrio campbellii carrying the pirVP gene causes acute hepatopancreatic necrosis disease. Emerg. Microbes Infec. 2017, 6, 1–3. [Google Scholar]
  10. Kumar, S.; Kumar, C.B.; Rajendran, V.; Abishaw, N.; Anand, P.S.; Kannapan, S.; Nagaleekar, V.K.; Vijayan, V.K.; Alavandi, S.V. Delineating virulence of Vibrio campbellii: A predominant luminescent bacterial pathogen in Indian shrimp hatcheries. Sci. Rep. 2021, 11, 15831. [Google Scholar] [CrossRef]
  11. Goarant, C.; Ansquer, D.; Herlin, J.; Domalain, D.; Imbert, F.; De Decker, S. “Summer Syndrome” in Litopenaeus stylirostris in New Caledonia: Pathology and epidemiology of the etiological agent, Vibrio nigripulchritudo. Aquaculture 2006, 253, 105–113. [Google Scholar] [CrossRef]
  12. Walling, E.; Vourey, E.; Ansquer, D.; Beliaeff, B.; Goarant, C. Vibrio nigripulchritudo monitoring and strain dynamics in shrimp pond sediments. J. Appl. Microbiol. 2010, 108, 2003–2011. [Google Scholar]
  13. Goarant, C.; Merien, F. Quantification of Vibrio penaeicida, the etiological agent of Syndrome 93 in New Caledonian shrimp, by real-time PCR using SYBR Green I chemistry. J. Microbiol. Methods 2006, 67, 27–35. [Google Scholar] [CrossRef]
  14. Maningas, M.B.B.; Kondo, H.; Hirono, I.; Saito-Taki, T.; Aoki, T. Essential function of transglutaminase and clotting protein in shrimp immunity. Mol. Immunol. 2008, 45, 1269–1275. [Google Scholar] [CrossRef] [PubMed]
  15. Horowitz, A.; Horowitz, S. Disease control in shrimp aquaculture from a microbial ecology perspective. In The New Wave, Proceedings of the Special Session on Sustainable Shrimp Culture, Aquaculture; World Aquaculture Society: Sorrento, LA, USA, 2001; pp. 199–218. [Google Scholar]
  16. Beijerinck, M.W. Le Photobacterium luminosum, Bactérie lumineuse de la Mer du Nord. Arch. Néerl. des Sci. Exact. et Nat. 1889, 23, 401–427. [Google Scholar]
  17. Gram, L.; Melchiorsen, J.; Bruhn, J.B. Antibacterial activity of marine culturable bacteria collected from a global sampling of ocean surface waters and surface swabs of marine organisms. Mar. Biotechnol. 2010, 12, 439–451. [Google Scholar] [CrossRef] [PubMed]
  18. Urbanczyk, H.; Ast, J.C.; Dunlap, P.V. Phylogeny, genomics, and symbiosis of Photobacterium. FEMS Microbiol. Rev. 2011, 35, 324–342. [Google Scholar] [CrossRef] [PubMed]
  19. Gomez-Gil, B.; Roque, A.; Rotllant, G.; Peinado, L.; Romalde, J.L.; Doce, A.; Cabanillas-Beltránla, H.; Chimetto, L.A.; Thompson, F.L. Photobacterium swingsii sp. nov., isolated from marine organisms. Int. J. Syst. Evol. Microbiol. 2011, 61, 315–319. [Google Scholar] [CrossRef]
  20. Enciso-Ibarra, J.; González-Castillo, A.; Soto-Rodriguez, S.A.; Enciso-Ibarra, K.; Bolán-Mejia, C.; Gomez-Gil, B. Photobacterium lucens sp. nov., Isolated from a Cultured Shrimp Penaeus vannamei. Curr. Microbiol. 2020, 77, 1111–1116. [Google Scholar] [CrossRef]
  21. Bjornsdottir-Butler, K.; McCarthy, S.A.; Dunlap, P.V.; Benner, R.A., Jr. Photobacterium angustum and Photobacterium kishitanii, psychrotrophic high-level histamine-producing bacteria indigenous to tuna. Appl. Environ. Microbiol. 2016, 82, 2167–2176. [Google Scholar] [CrossRef]
  22. Wang, X.; Li, Y.; Xue, C.X.; Li, B.; Zhou, S.; Liu, L.; Zhang, X.H. Photobacterium chitinilyticum sp. nov., a marine bacterium isolated from seawater at the bottom of the East China Sea. Int. J. Syst. Evol. Microbiol. 2019, 69, 1477–1483. [Google Scholar] [CrossRef]
  23. Vaseeharan, B.; Sundararaj, S.; Murugan, T.; Chen, J.C. Photobacterium damselae ssp. damselae associated with diseased black tiger shrimp Penaeus monodon Fabricius in India. Lett. Appl. Microbiol. 2007, 45, 82–86. [Google Scholar]
  24. Wang, Z.; Shi, C.; Wang, H.; Wan, X.; Zhang, Q.; Song, X.; Li, G.; Gong, M.; Ye, S.; Xie, G.; et al. A novel research on isolation and characterization of Photobacterium damselae subsp. damselae from Pacific white shrimp, Penaeus vannamei, displaying black gill disease cultured in China. J. Fish Dis. 2020, 43, 551–559. [Google Scholar]
  25. Nadala, E.C.B., Jr.; Tapay, L.M.; Cao, S.; Loh, P.C. Detection of yellowhead virus and Chinese baculovirus in penaeid shrimp by the Western blot technique. J. Virol. Methods 1997, 69, 39–44. [Google Scholar] [CrossRef] [PubMed]
  26. Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
  27. Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed]
  28. Manzoor, A.; UlAbdin, Z.; Webb, B.A.; Arif, M.J.; Jamil, A. De novo sequencing and transcriptome analysis of female venom glands of ectoparasitoid Bracon hebetor (Say.) (Hymenoptera: Braconidae). Comp. Biochem. Physiol. Part D Genom. Proteom. 2016, 20, 101–110. [Google Scholar] [CrossRef]
  29. Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef]
  30. Wang, L.; Feng, Z.; Wang, X.; Wang, X.; Zhang, X. DEGseq: An R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics 2010, 26, 136–138. [Google Scholar] [CrossRef]
  31. Audic, S.; Claverie, J.M. The significance of digital gene expression profiles. Genome Res. 1997, 7, 986–995. [Google Scholar] [CrossRef]
  32. Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef]
  33. Wu, J.; Mao, X.; Cai, T.; Luo, J.; Wei, L. KOBAS server: A web-based platform for automated annotation and pathway identification. Nucleic Acids Res. 2006, 34, W720–W724. [Google Scholar] [CrossRef]
  34. Xie, C.; Mao, X.; Huang, J.; Ding, Y.; Wu, J.; Dong, S.; Kong, L.; Gao, G.; Li, C.; Wei, L. KOBAS 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011, 39, W316–W322. [Google Scholar] [CrossRef] [PubMed]
  35. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
  36. Chen, K.; Song, J.; Song, Q.; Dou, X.; Wang, Y.; Wei, Y.; Chen, J.; Wang, L.; Alradi, M.F.; Liu, X.; et al. Transcriptomic analysis provides insights into the immune responses and nutrition in Ostrinia furnacalis larvae parasitized by Macrocentrus cingulum. Arch. Insect Biochem. Physiol. 2022, 109, e21863. [Google Scholar] [CrossRef] [PubMed]
  37. Shi, W.; Wang, P.; Hu, R.; Wan, X.; Shen, H.; Li, H.; Wang, L.; Qiao, Y.; Jiang, G.; Cheng, J.; et al. Transcriptome analysis reveals hub genes in the hepatopancreas of Exopalaemon carinicauda in response to hypoxia and reoxygenation. Aquac. Int. 2021, 29, 1785–1811. [Google Scholar] [CrossRef]
  38. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  39. Wang, L.; Liu, X.; Han, Z.; Li, S.; Feng, C. Selective strengthening of lipid metabolism and the rapid immune response of Ostrinia furnacalis larvae parasitized by Macrocentrus cingulum. J. Asia Pac. Èntomol. 2024, 27, 102194. [Google Scholar] [CrossRef]
  40. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  41. Kirti, N.; Tekade, S.P.; Tagade, A.; Sawarkar, A.N. Pyrolysis of pigeon pea (Cajanus cajan) stalk: Kinetics and thermodynamic analysis of degradation stages via isoconversional and master plot methods. Bioresour. Technol. 2022, 347, 126440. [Google Scholar] [CrossRef]
  42. Zhao, T.; Ma, A.; Huang, Z.; Liu, Z.; Sun, Z.; Zhu, C.; Yang, J.; Li, Y.; Wang, Q.; Qiao, X.; et al. Transcriptome analysis reveals that high temperatures alter modes of lipid metabolism in juvenile turbot (Scophthalmus maximus) liver. Comp. Biochem. Physiol. Part D Genom. Proteom. 2021, 40, 100887. [Google Scholar] [CrossRef]
  43. de Souza Valente, C.; Wan, A.H.L. Vibrio and major commercially important vibriosis diseases in decapod crustaceans. J. Invertebr. Pathol. 2021, 181, 107527. [Google Scholar] [CrossRef]
  44. Bachère, E. Anti-infectious immune effectors in marine invertebrates: Potential tools for disease control in larviculture. Aquaculture 2003, 227, 427–438. [Google Scholar] [CrossRef]
  45. Thitamadee, S.; Prachumwat, A.; Srisala, J.; Jaroenlak, P.; Salachan, P.V.; Sritunyalucksana, K.; Flege, T.W.; Itsathitphaisarn, O. Review of current disease threats for cultivated penaeid shrimp in Asia. Aquaculture 2016, 452, 69–87. [Google Scholar] [CrossRef]
  46. Ina-Salwany, M.Y.; Al-saari, N.; Mohamad, A.; Mursidi, F.A.; Mohd-Aris, A.; Amal, M.N.A.; Kasai, H.; Mino, S.; Sawabe, T.; Zamri-Saad, M. Vibriosis in fish: A review on disease development and prevention. J. Aquat. Anim. Health 2019, 31, 3–22. [Google Scholar] [CrossRef] [PubMed]
  47. Goulden, E.F.; Hall, M.R.; Bourne, D.G.; Pereg, L.L.; Høj, L. Pathogenicity and infection cycle of Vibrio owensii in larviculture of the ornate spiny lobster (Panulirus ornatus). Appl. Environ. Microbiol. 2012, 78, 2841–2849. [Google Scholar] [CrossRef]
  48. Kumar, T.S.; Vidya, R.; Kumar, S.; Alavandi, S.V.; Vijayan, K.K. Zoea-2 syndrome of Penaeus vannamei in shrimp hatcheries. Aquaculture 2017, 479, 759–767. [Google Scholar] [CrossRef]
  49. Olguín-León, P.; Enríquez-Espinoza, T.; Mendoza-Cano, F.; Encinas-García, T.; Sánchez-Paz, A. Transcriptional profile of pyruvate kinase and pancreatic lipase encoding mRNA s of the Pacific whiteleg shrimp Penaeus vannamei during Pst DV-1 infection. Aquac. Res. 2017, 48, 5587–5594. [Google Scholar] [CrossRef]
  50. Kuo, Y.C.; Chen, I.Y.; Chang, S.C.; Wu, S.C.; Hung, T.M.; Lee, P.H.; Shimotohno, K.; Chang, M.F. Hepatitis C virus NS 5A protein enhances gluconeogenesis through upregulation of Akt-/JNK-PEPCK signalling pathways. Liver Int. 2014, 34, 1358–1368. [Google Scholar] [CrossRef]
  51. Parvaiz, F.; Manzoor, S.; Iqbal, J.; Sarkar-Dutta, M.; Imran, M.; Waris, G. Hepatitis C virus NS5A promotes insulin resistance through IRS-1 serine phosphorylation and increased gluconeogenesis. World J. Gastroenterol. 2015, 21, 12361–12369. [Google Scholar] [CrossRef]
  52. Stuck, K.C.; Stuck, L.M.; Overstreet, R.M.; Wang, S.Y. Relationship between BP (Baculovirus penaei) and energy reserves in larval and postlarval Pacific white shrimp Penaeus vannamei. Dis. Aquat. Organ. 1996, 24, 191–198. [Google Scholar] [CrossRef]
  53. Parvy, J.P.; Napal, L.; Rubin, T.; Poidevin, M.; Perrin, L.; Wicker-Thomas, C.; Montagne, J. Drosophila melanogaster Acetyl-CoA-carboxylase sustains a fatty acid-dependent remote signal to waterproof the respiratory system. PLoS Genet. 2012, 8, e1002925. [Google Scholar] [CrossRef] [PubMed]
  54. Hossain, M.I.; Roulston, C.L.; Stapleton, D.I. Molecular basis of impaired glycogen metabolism during ischemic stroke and hypoxia. PLoS ONE 2014, 9, e97570. [Google Scholar] [CrossRef] [PubMed]
  55. Garrido, D.; Rubin, T.; Poidevin, M.; Maroni, B.; Rouzic, A.L.; Parvy, J.P.; Montagne, J. Fatty acid synthase cooperates with glyoxalase 1 to protect against sugar toxicity. PLoS Genet. 2015, 11, e1004995. [Google Scholar] [CrossRef]
  56. Tunnacliffe, A.; Lapinski, J. Resurrecting Van Leeuwenhoek’s rotifers: A reappraisal of the role of disaccharides in anhydrobiosis. Philos. Trans. R. Soc. B Biol. Sci. 2003, 358, 1755–1771. [Google Scholar] [CrossRef]
  57. MacRae, T.H. Stress tolerance during diapause and quiescence of the brine shrimp, Artemia. Cell Stress Chaperones 2016, 21, 9–18. [Google Scholar] [CrossRef]
  58. Wang, B.; Li, F.H.; Dong, B.; Zhang, X.; Zhang, C.; Xiang, J. Discovery of the Genes in Response to White Spot Syndrome Virus (WSSV) Infection in Fenneropenaeus chinensis through cDNA Microarray. Mar. Biotechnol. 2006, 8, 491–500. [Google Scholar] [CrossRef]
  59. Gross, P.S.; Bartlett, T.C.; Browdy, C.L.; Chapman, R.W.; Warr, G.W. Immune gene discovery by expressed sequence tag analysis of hemocytes and hepatopancreas in the Pacific White Shrimp, Litopenaeus vannamei, and the Atlantic White Shrimp. L. setiferus. Dev. Comp. Immunol. 2001, 25, 565–577. [Google Scholar] [CrossRef]
  60. Li, F.; Xiang, J. Signaling pathways regulating innate immune responses in shrimp. Fish Shellfish Immunol. 2013, 34, 973–980. [Google Scholar] [CrossRef]
  61. Lei, K.; Li, F.; Zhang, M.; Yang, H.; Luo, T.; Xu, X. Difference between hemocyanin subunits from shrimp Penaeus japonicus in anti-WSSV defense. Dev. Comp. Immunol. 2008, 32, 808–813. [Google Scholar] [CrossRef]
  62. Burmester, T. Evolution of respiratory proteins across the Pancrustacea. Integr. Comp. Biol. 2015, 55, 792–801. [Google Scholar] [CrossRef]
  63. Boonchuen, P.; Jaree, P.; Tassanakajon, A.; Somboonwiwat, K. Hemocyanin of Litopenaeus vannamei agglutinates Vibrio parahaemolyticus AHPND (VPAHPND) and neutralizes its toxin. Dev. Comp. Immunol. 2018, 84, 371–381. [Google Scholar] [CrossRef] [PubMed]
  64. Amparyup, P.; Charoensapsri, W.; Tassanakajon, A. Two prophenoloxidases are important for the survival of Vibrio harveyi challenged shrimp Penaeus monodon. Dev. Comp. Immunol. 2009, 33, 247–256. [Google Scholar] [CrossRef] [PubMed]
  65. Charoensapsri, W.; Amparyup, P.; Hirono, I.; Aoki, T.; Tassanakajon, A. PmPPAE2, a new class of crustacean prophenoloxidase (proPO)-activating enzyme and its role in PO activation. Dev. Comp. Immunol. 2011, 35, 115–124. [Google Scholar] [CrossRef]
  66. Amparyup, P.; Promrungreang, K.; Charoensapsri, W.; Sutthangkul, J.; Tassanakajon, A. A serine proteinase PmClipSP2 contributes to prophenoloxidase system and plays a protective role in shrimp defense by scavenging lipopolysaccharide. Dev. Comp. Immunol. 2013, 41, 597–607. [Google Scholar] [CrossRef]
  67. Niere, M.; Dettloff, M.; Maier, T.; Ziegler, M.; Wiesner, A. Insect immune activation by apolipophorin III is correlated with the lipid-binding properties of this protein. Biochemistry 2001, 40, 11502–11508. [Google Scholar] [CrossRef]
  68. Contreras, E.; Rausell, C.; Real, M.D. Tribolium castaneum apolipophorin-III acts as an immune response protein against Bacillus thuringiensis Cry3Ba toxic activity. J. Invertebr. Pathol. 2013, 113, 209–213. [Google Scholar] [CrossRef] [PubMed]
  69. Wen, D.; Wang, X.; Shang, L.; Huang, Y.; Li, T.; Wu, C.; Zhang, R.; Zhang, J. Involvement of a versatile pattern recognition receptor, apolipophorin-III in prophenoloxidase activation and antibacterial defense of the Chinese oak silkworm, Antheraea pernyi. Dev. Comp. Immunol. 2016, 65, 124–131. [Google Scholar] [CrossRef]
  70. Gorowara, S.; Sapru, S.; Ganguly, N.K. Role of intracellular second messengers and reactive oxygen species in the pathophysiology of V. cholera O139 treated rabbit ileum. Biochim. Biophys. Acta Mol. Basis Dis. 1998, 1407, 21–30. [Google Scholar] [CrossRef]
  71. Pajares, M.A.; Pérez-Sala, D. Betaine homocysteine S-methyltransferase: Just a regulator of homocysteine metabolism? Cell. Mol. Life Sci. 2006, 63, 2792–2803. [Google Scholar] [CrossRef]
  72. Ji, C.; Shinohara, M.; Kuhlenkamp, J.; Chan, C.; Kaplowitz, N. Mechanisms of protection by the betaine-homocysteine methyltransferase/betaine system in HepG2 cells and primary mouse hepatocytes. Hepatology 2007, 46, 1586–1596. [Google Scholar] [CrossRef] [PubMed]
  73. Wrońska, A.K.; Boguś, M.I. Heat shock proteins (HSP 90, 70, 60, and 27) in Galleria mellonella (Lepidoptera) hemolymph are affected by infection with Conidiobolus coronatus (Entomophthorales). PLoS ONE 2020, 15, e0228556. [Google Scholar] [CrossRef] [PubMed]
  74. Bendena, W.G.; Ayme-Southgate, A.; Garbe, J.C.; Pardue, M.L. Expression of heat-shock locus hsr-omega in nonstressed cells during development in Drosophila melanogaster. Dev. Biol. 1991, 144, 65–77. [Google Scholar] [CrossRef] [PubMed]
  75. Wojda, I.; Jakubowicz, T. Humoral immune response upon mild heat-shock conditions in Galleria mellonella larvae. J. Insect Physiol. 2007, 53, 1134–1144. [Google Scholar] [CrossRef]
  76. Liu, Q.N.; Liu, Y.; Xin, Z.Z.; Zhu, X.Y.; Ge, B.M.; Li, C.F.; Wang, D.; Bian, X.G.; Yang, L.; Chen, L.; et al. A small heat shock protein 21 (sHSP21) mediates immune responses in Chinese oak silkworm Antheraea pernyi. Int. J. Biol. Macromol. 2018, 111, 1027–1031. [Google Scholar] [CrossRef]
  77. Qi, C.; Wang, L.; Liu, M.; Jiang, K.; Wang, M.; Zhao, W.; Wang, B. Transcriptomic and morphological analyses of Litopenaeus vannamei intestinal barrier in response to Vibrio paraheamolyticus infection reveals immune response signatures and structural disruption. Fish Shellfish Immunol. 2017, 70, 437–450. [Google Scholar] [CrossRef]
  78. Rao, R.; Bing Zhu, Y.; Alinejad, T.; Tiruvayipati, S.; Lin Thong, K.; Wang, J.; Bhassu, S. RNA-seq analysis of Macrobrachium rosenbergii hepatopancreas in response to Vibrio parahaemolyticus infection. Gut Pathog. 2015, 7, 6. [Google Scholar] [CrossRef]
Fishes 09 00350 g001
Figure 1. Schematic diagram of the experimental design.
Figure 1. Schematic diagram of the experimental design.
Fishes 09 00350 g001
Fishes 09 00350 g002
Figure 2. Volcano plot picture of the differentially expressed genes of L. vannamei under an artificial challenge.
Figure 2. Volcano plot picture of the differentially expressed genes of L. vannamei under an artificial challenge.
Fishes 09 00350 g002
Fishes 09 00350 g003
Figure 3. The DEGs in the infected L. vannamei were clustered into six assemblages (DEGs, fold change of >2, p-value of <0.005). DEG, differential expression gene; DS, DEGs in the shrimp infected with P. damselae; NS, DEGs in the control group of the shrimp injected with sterilized physiological saline.
Figure 3. The DEGs in the infected L. vannamei were clustered into six assemblages (DEGs, fold change of >2, p-value of <0.005). DEG, differential expression gene; DS, DEGs in the shrimp infected with P. damselae; NS, DEGs in the control group of the shrimp injected with sterilized physiological saline.
Fishes 09 00350 g003
Fishes 09 00350 g004aFishes 09 00350 g004b
Figure 4. Hierarchical cluster results of the transcripts of the energetic metabolism-related (A) and immune response-related (B) genes in the infected L. vannamei. DS, shrimp infected with P. damselae; NS, control group of the shrimp injected with sterilized physiological saline.
Figure 4. Hierarchical cluster results of the transcripts of the energetic metabolism-related (A) and immune response-related (B) genes in the infected L. vannamei. DS, shrimp infected with P. damselae; NS, control group of the shrimp injected with sterilized physiological saline.
Fishes 09 00350 g004aFishes 09 00350 g004b
Fishes 09 00350 g005
Figure 5. Expression profiles of the energetic metabolism- and immune response-related genes in the infected L. vannamei. APO, Apolipoprotein; TPS, trehalose-6-phosphate synthase; Mttp, Microsomal triglyceride transfer protein; Lipl-1, triacylglycerol lipase; Serpin, serine proteinase inhibitor; MAPK, mitogen-activated protein kinase kinase; GPX, glutathione peroxidase; CAT, catalase. DS, shrimp infected with P. damselae; NS, control group of the shrimp injected with sterilized physiological saline. Two treatment groups (NS and DS) were set up in the experiment, with triplicates per treatment (**: p < 0.01, and ***: p < 0.001).
Figure 5. Expression profiles of the energetic metabolism- and immune response-related genes in the infected L. vannamei. APO, Apolipoprotein; TPS, trehalose-6-phosphate synthase; Mttp, Microsomal triglyceride transfer protein; Lipl-1, triacylglycerol lipase; Serpin, serine proteinase inhibitor; MAPK, mitogen-activated protein kinase kinase; GPX, glutathione peroxidase; CAT, catalase. DS, shrimp infected with P. damselae; NS, control group of the shrimp injected with sterilized physiological saline. Two treatment groups (NS and DS) were set up in the experiment, with triplicates per treatment (**: p < 0.01, and ***: p < 0.001).
Fishes 09 00350 g005
Fishes 09 00350 g006
Figure 6. Changes in the TAG and trehalose concentrations and activities of PO, TPS, lysozyme, CAT, and GSH-PX in the hemolymph samples of the infected L. vannamei. The hemolymph samples harvested from the infected L. vannamei were used for measuring the TAG (A) and trehalose concentrations (B), PO activity (C), TPS activity (D), lysozyme activity (E), CAT activity (F), and GSH-PX activity (G). DS, shrimp infected with P. damselae; NS, control group of the shrimp injected with sterilized physiological saline. Two treatment groups (NS and DS) were set up in the experiment, with triplicates per treatment (***: p < 0.001).
Figure 6. Changes in the TAG and trehalose concentrations and activities of PO, TPS, lysozyme, CAT, and GSH-PX in the hemolymph samples of the infected L. vannamei. The hemolymph samples harvested from the infected L. vannamei were used for measuring the TAG (A) and trehalose concentrations (B), PO activity (C), TPS activity (D), lysozyme activity (E), CAT activity (F), and GSH-PX activity (G). DS, shrimp infected with P. damselae; NS, control group of the shrimp injected with sterilized physiological saline. Two treatment groups (NS and DS) were set up in the experiment, with triplicates per treatment (***: p < 0.001).
Fishes 09 00350 g006
Table 1. Primers used in the RT-qPCR.
Table 1. Primers used in the RT-qPCR.
Gene IDPrimerSequence (5′~3′)
ncbi_113815027APO-FTGCCAGATTTACTACACCAGACC
APO-RTCTCCTACGACGGGTACTCC
ncbi_113807145TPS-FTTCTGCGCACACTATTTGGC
TPS-RACCCACTTGAGCATGGTGAG
ncbi_113810715Mttp-FTTTGTGTGTGTGTGATGCGG
Mttp-RAAGGCATACTGGACATCCTGAG
ncbi_113813342Lipl-FCTTTCGAACATGCGCGGAAA
Lipl-RCAATGCTCGCAGGAACATCG
ncbi_113800366Serpin2-FGGACCTTAAGCCTTGGGGTT
Serpin2-RCATCCACAAGGCCTTCGTCG
ncbi_113829534MAPK-FCGGACTTCAGTATCCTGTGCA
MAPK-RTTCGCAAATGGTGAAATATGCA
MSTRG.8004GPX-FAACTGCGGCTTCACTCAAGA
GPX-RGTCTCGCCCGAAGAGGAATT
ncbi_113829896CAT-FGGGATCCTATTCTGTTCCCATCC
CAT-RTGACAAGCTTGGAAGTACGAGA
β actinβ actin-FGCATCACCAGGGCTACAT
β actin-RGTCGCCACGAGAAGTCAA
Table 2. Assembly statistics of the transcripts.
Table 2. Assembly statistics of the transcripts.
SampleClean ReadsClean Data (bp)GC Content (%)Q30 (%)Mapped (%)
NS-139,264,5665,865,190,60549.6390.2587.32
NS-236,038,4025,382,295,98947.8789.6386.58
NS-335,945,8085,368,259,43748.0989.8386.24
DS-138,381,8425,739,457,81147.4489.7786.91
DS-236,176,6405,407,108,46048.2090.9088.46
DS-335,943,3645,364,241,15748.1489.7687.19
Table 3. The success rates of the annotated new genes in the L. vannamei transcriptome data.
Table 3. The success rates of the annotated new genes in the L. vannamei transcriptome data.
ItemNumber of UnigenesPercentage (%)
Nr38732.3
KEGG21417.9
GO59549.8
Total unigenes1196100
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, L.; Xu, Q.; Yu, Z.; Hu, Z.; Li, H.; Shi, W.; Wan, X. Transcriptomic Analysis Provides Insights into the Energetic Metabolism and Immune Responses in Litopenaeus vannamei Challenged by Photobacterium damselae subsp. damselae. Fishes 2024, 9, 350. https://doi.org/10.3390/fishes9090350

AMA Style

Wang L, Xu Q, Yu Z, Hu Z, Li H, Shi W, Wan X. Transcriptomic Analysis Provides Insights into the Energetic Metabolism and Immune Responses in Litopenaeus vannamei Challenged by Photobacterium damselae subsp. damselae. Fishes. 2024; 9(9):350. https://doi.org/10.3390/fishes9090350

Chicago/Turabian Style

Wang, Libao, Qiuwen Xu, Zhijun Yu, Zhenxin Hu, Hui Li, Wenjun Shi, and Xihe Wan. 2024. "Transcriptomic Analysis Provides Insights into the Energetic Metabolism and Immune Responses in Litopenaeus vannamei Challenged by Photobacterium damselae subsp. damselae" Fishes 9, no. 9: 350. https://doi.org/10.3390/fishes9090350

Article Metrics

Back to TopTop