Taurine Ameliorates Tunicamycin-Induced Liver Injury by Disrupting the Vicious Cycle between Oxidative Stress and Endoplasmic Reticulum Stress
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal and Treatments
2.2. Examination of Serum Biochemical Parameters
2.3. Examination of Hematoxylin and Eosin Staining for Liver Histology
2.4. Immunoblotting Analysis
2.5. Real-Time Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
2.6. Examination of Triglycerides (TG) in the Liver
2.7. Examination of Oil Red O Staining
2.8. Examination of Free Fatty Acids (FFA) in the Liver
2.9. Determination of Blood Very-Low-Density Lipoprotein (VLDL) Level
2.10. Examination of Hepatic Lipid Peroxidation
2.11. Examination of Sulfur-Containing Metabolites
2.12. Examination of Reactive Oxygen Species (ROS) Generation
2.13. Statistical Analysis
3. Results
3.1. Taurine Alleviated Tunicamycin-Induced Hepatotoxicity in Mice
3.2. Taurine Attenuated Tunicamycin-Induced ER Stress Response in the Liver
3.3. Taurine Prevented Tunicamycin-Induced Lipid Accumulation in the Liver
3.4. Taurine Inhibited Tunicamycin-Induced Hepatic Oxidative Stress in Mice
3.5. Taurine Recovered Tunicamycin-Induced Aberrant Cysteine Catabolism in the Liver
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pierantonelli, I.; Svegliati-Baroni, G. Nonalcoholic Fatty Liver Disease: Basic Pathogenetic Mechanisms in the Progression from NAFLD to NASH. Transplantation 2019, 103, e1–e13. [Google Scholar] [CrossRef]
- Brunt, E.M.; Wong, V.W.; Nobili, V.; Day, C.P.; Sookoian, S.; Maher, J.J.; Bugianesi, E.; Sirlin, C.B.; Neuschwander-Tetri, B.A.; Rinella, M.E. Nonalcoholic fatty liver disease. Nat. Rev. Dis. Primers 2015, 1, 15080. [Google Scholar] [CrossRef] [PubMed]
- Lebeaupin, C.; Vallee, D.; Hazari, Y.; Hetz, C.; Chevet, E.; Bailly-Maitre, B. Endoplasmic reticulum stress signalling and the pathogenesis of non-alcoholic fatty liver disease. J. Hepatol. 2018, 69, 927–947. [Google Scholar] [CrossRef]
- Friedman, S.L.; Neuschwander-Tetri, B.A.; Rinella, M.; Sanyal, A.J. Mechanisms of NAFLD development and therapeutic strategies. Nat. Med. 2018, 24, 908–922. [Google Scholar] [CrossRef]
- Kawano, Y.; Cohen, D.E. Mechanisms of hepatic triglyceride accumulation in non-alcoholic fatty liver disease. J. Gastroenterol. 2013, 48, 434–441. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Byrne, C.D.; Targher, G. NAFLD: A multisystem disease. J. Hepatol. 2015, 62, S47–S64. [Google Scholar] [CrossRef] [Green Version]
- Neuschwander-Tetri, B.A. Non-alcoholic fatty liver disease. BMC Med. 2017, 15, 45. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chalasani, N.; Younossi, Z.; Lavine, J.E.; Diehl, A.M.; Brunt, E.M.; Cusi, K.; Charlton, M.; Sanyal, A.J. The diagnosis and management of non-alcoholic fatty liver disease: Practice Guideline by the American Association for the Study of Liver Diseases, American College of Gastroenterology, and the American Gastroenterological Association. Hepatology 2012, 55, 2005–2023. [Google Scholar] [CrossRef]
- Gentile, C.L.; Nivala, A.M.; Gonzales, J.C.; Pfaffenbach, K.T.; Wang, D.; Wei, Y.; Jiang, H.; Orlicky, D.J.; Petersen, D.R.; Pagliassotti, M.J.; et al. Experimental evidence for therapeutic potential of taurine in the treatment of nonalcoholic fatty liver disease. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2011, 301, R1710–R1722. [Google Scholar] [CrossRef]
- Wang, M.; Kaufman, R.J. Protein misfolding in the endoplasmic reticulum as a conduit to human disease. Nature 2016, 529, 326–335. [Google Scholar] [CrossRef]
- Schwarz, D.S.; Blower, M.D. The endoplasmic reticulum: Structure, function and response to cellular signaling. Cell Mol. Life Sci. 2016, 73, 79–94. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frakes, A.E.; Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Mol. Cell 2017, 66, 761–771. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Engin, F. ER stress and development of type 1 diabetes. J. Investig. Med. 2016, 64, 2–6. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Yang, X.; Zhang, J. Bridges between mitochondrial oxidative stress, ER stress and mTOR signaling in pancreatic beta cells. Cell. Signal. 2016, 28, 1099–1104. [Google Scholar] [CrossRef]
- Walter, P.; Ron, D. The unfolded protein response: From stress pathway to homeostatic regulation. Science 2011, 334, 1081–1086. [Google Scholar] [CrossRef] [Green Version]
- Han, J.; Kaufman, R.J. The role of ER stress in lipid metabolism and lipotoxicity. J. Lipid Res. 2016, 57, 1329–1338. [Google Scholar] [CrossRef] [Green Version]
- Wen, C.; Li, F.; Zhang, L.; Duan, Y.; Guo, Q.; Wang, W.; He, S.; Li, J.; Yin, Y. Taurine is Involved in Energy Metabolism in Muscles, Adipose Tissue, and the Liver. Mol. Nutr. Food Res. 2019, 63, e1800536. [Google Scholar] [CrossRef]
- Song, Q.; Guo, J.; Zhang, Y.; Chen, W. The beneficial effects of taurine in alleviating fatty liver disease. J. Funct. Foods 2021, 77, 104351. [Google Scholar] [CrossRef]
- Wang, Z.; Ohata, Y.; Watanabe, Y.; Yuan, Y.; Yoshii, Y.; Kondo, Y.; Nishizono, S.; Chiba, T. Taurine Improves Lipid Metabolism and Increases Resistance to Oxidative Stress. J. Nutr. Sci. Vitaminol. 2020, 66, 347–356. [Google Scholar] [CrossRef]
- Hagar, H.H. The protective effect of taurine against cyclosporine A-induced oxidative stress and hepatotoxicity in rats. Toxicol. Lett. 2004, 151, 335–343. [Google Scholar] [CrossRef]
- Baliou, S.; Adamaki, M.; Ioannou, P.; Pappa, A.; Panayiotidis, M.I.; Spandidos, D.A.; Christodoulou, I.; Kyriakopoulos, A.M.; Zoumpourlis, V. Protective role of taurine against oxidative stress (Review). Mol. Med. Rep. 2021, 24, 605. [Google Scholar] [CrossRef]
- Zhang, Y.; Wei, Z.; Yang, M.; Liu, D.; Pan, M.; Wu, C.; Zhang, W.; Mai, K. Dietary taurine modulates hepatic oxidative status, ER stress and inflammation in juvenile turbot (Scophthalmus maximus L.) fed high carbohydrate diets. Fish Shellfish. Immunol. 2021, 109, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Miyata, M.; Funaki, A.; Fukuhara, C.; Sumiya, Y.; Sugiura, Y. Taurine attenuates hepatic steatosis in a genetic model of fatty liver disease. J. Toxicol. Sci. 2020, 45, 87–94. [Google Scholar] [CrossRef] [Green Version]
- Zhu, W.; Chen, S.; Chen, R.; Peng, Z.; Wan, J.; Wu, B. Taurine and tea polyphenols combination ameliorate nonalcoholic steatohepatitis in rats. BMC Complement. Altern. Med. 2017, 17, 455. [Google Scholar] [CrossRef] [Green Version]
- Reitman, S.; Frankel, S. A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am. J. Clin. Pathol. 1957, 28, 56–63. [Google Scholar] [CrossRef] [PubMed]
- Volpi, N.; Tarugi, P. Improvement in the high-performance liquid chromatography malondialdehyde level determination in normal human plasma. J. Chromatogr. B Biomed. Sci. Appl. 1998, 713, 433–437. [Google Scholar] [CrossRef]
- Jung, Y.S.; Kim, S.J.; Kwon, D.Y.; Kim, Y.C. Comparison of the effects of buthioninesulfoximine and phorone on the metabolism of sulfur-containing amino acids in rat liver. Biochem. Biophys. Res. Commun. 2008, 368, 913–918. [Google Scholar] [CrossRef]
- Ide, T. Simple high-performance liquid chromatographic method for assaying cysteinesulfinic acid decarboxylase activity in rat tissue. J. Chromatogr. B Biomed. Sci. Appl. 1997, 694, 325–332. [Google Scholar] [CrossRef]
- Nolin, T.D.; McMenamin, M.E.; Himmelfarb, J. Simultaneous determination of total homocysteine, cysteine, cysteinylglycine, and glutathione in human plasma by high-performance liquid chromatography: Application to studies of oxidative stress. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 2007, 852, 554–561. [Google Scholar] [CrossRef] [Green Version]
- Kaufman, R.J. Stress signaling from the lumen of the endoplasmic reticulum: Coordination of gene transcriptional and translational controls. Genes Dev. 1999, 13, 1211–1233. [Google Scholar] [CrossRef] [Green Version]
- Jo, H.; Choe, S.S.; Shin, K.C.; Jang, H.; Lee, J.H.; Seong, J.K.; Back, S.H.; Kim, J.B. Endoplasmic reticulum stress induces hepatic steatosis via increased expression of the hepatic very low-density lipoprotein receptor. Hepatology 2013, 57, 1366–1377. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, P.; Leray, V.; Diez, M.; Serisier, S.; Le Bloc’h, J.; Siliart, B.; Dumon, H. Liver lipid metabolism. J. Anim. Physiol. Anim. Nutr. 2008, 92, 272–283. [Google Scholar] [CrossRef] [PubMed]
- Ipsen, D.H.; Lykkesfeldt, J.; Tveden-Nyborg, P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell. Mol. Life Sci. 2018, 75, 3313–3327. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Malhotra, J.D.; Kaufman, R.J. Endoplasmic reticulum stress and oxidative stress: A vicious cycle or a double-edged sword? Antioxid. Redox. Signal. 2007, 9, 2277–2293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Murakami, S. Role of taurine in the pathogenesis of obesity. Mol. Nutr. Food Res. 2015, 59, 1353–1363. [Google Scholar] [CrossRef]
- Niu, X.; Zheng, S.; Liu, H.; Li, S. Protective effects of taurine against inflammation, apoptosis, and oxidative stress in brain injury. Mol. Med. Rep. 2018, 18, 4516–4522. [Google Scholar] [CrossRef] [Green Version]
- Abd Elwahab, A.H.; Ramadan, B.K.; Schaalan, M.F.; Tolba, A.M. A Novel Role of SIRT1/ FGF-21 in Taurine Protection against Cafeteria Diet-Induced Steatohepatitis in Rats. Cell Physiol. Biochem. 2017, 43, 644–659. [Google Scholar] [CrossRef]
- Murakami, S.; Ono, A.; Kawasaki, A.; Takenaga, T.; Ito, T. Taurine attenuates the development of hepatic steatosis through the inhibition of oxidative stress in a model of nonalcoholic fatty liver disease in vivo and in vitro. Amino Acids 2018, 50, 1279–1288. [Google Scholar] [CrossRef]
- Yang, M.; Zhang, D.; Zhao, Z.; Sit, J.; Saint-Sume, M.; Shabandri, O.; Zhang, K.; Yin, L.; Tong, X. Hepatic E4BP4 induction promotes lipid accumulation by suppressing AMPK signaling in response to chemical or diet-induced ER stress. FASEB J. 2020, 34, 13533–13547. [Google Scholar] [CrossRef]
- Feng, B.; Huang, X.; Jiang, D.; Hua, L.; Zhuo, Y.; Wu, D. Endoplasmic Reticulum Stress Inducer Tunicamycin Alters Hepatic Energy Homeostasis in Mice. Int. J. Mol. Sci. 2017, 18, 1710. [Google Scholar] [CrossRef]
- Kim, S.H.; Kwon, D.Y.; Kwak, J.H.; Lee, S.; Lee, Y.H.; Yun, J.; Son, T.G.; Jung, Y.S. Tunicamycin-Induced ER Stress is Accompanied with Oxidative Stress via Abrogation of Sulfur Amino Acids Metabolism in the Liver. Int. J. Mol. Sci. 2018, 19, 4114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, S.; Kaufman, R.J. How does protein misfolding in the endoplasmic reticulum affect lipid metabolism in the liver? Curr. Opin. Lipidol. 2014, 25, 125–132. [Google Scholar] [CrossRef] [PubMed]
- Silverstein, R.L.; Febbraio, M. CD36, a scavenger receptor involved in immunity, metabolism, angiogenesis, and behavior. Sci. Signal. 2009, 2, re3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koonen, D.P.; Jacobs, R.L.; Febbraio, M.; Young, M.E.; Soltys, C.L.; Ong, H.; Vance, D.E.; Dyck, J.R. Increased hepatic CD36 expression contributes to dyslipidemia associated with diet-induced obesity. Diabetes 2007, 56, 2863–2871. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilson, C.G.; Tran, J.L.; Erion, D.M.; Vera, N.B.; Febbraio, M.; Weiss, E.J. Hepatocyte-Specific Disruption of CD36 Attenuates Fatty Liver and Improves Insulin Sensitivity in HFD-Fed Mice. Endocrinology 2016, 157, 570–585. [Google Scholar] [CrossRef] [Green Version]
- Oakes, S.A.; Papa, F.R. The role of endoplasmic reticulum stress in human pathology. Annu. Rev. Pathol. 2015, 10, 173–194. [Google Scholar] [CrossRef] [Green Version]
- Zhang, K.; Kaufman, R.J. From endoplasmic-reticulum stress to the inflammatory response. Nature 2008, 454, 455–462. [Google Scholar] [CrossRef] [Green Version]
- Cao, S.S.; Kaufman, R.J. Endoplasmic reticulum stress and oxidative stress in cell fate decision and human disease. Antioxid. Redox. Signal. 2014, 21, 396–413. [Google Scholar] [CrossRef]
- Polimeni, L.; Del Ben, M.; Baratta, F.; Perri, L.; Albanese, F.; Pastori, D.; Violi, F.; Angelico, F. Oxidative stress: New insights on the association of non-alcoholic fatty liver disease and atherosclerosis. World J. Hepatol. 2015, 7, 1325–1336. [Google Scholar] [CrossRef]
- Betteridge, D.J. What is oxidative stress? Metabolism 2000, 49, 3–8. [Google Scholar] [CrossRef]
- Kim, S.K.; Kim, Y.C. Effects of betaine supplementation on hepatic metabolism of sulfur-containing amino acids in mice. J. Hepatol. 2005, 42, 907–913. [Google Scholar] [CrossRef] [PubMed]
- Cuozzo, J.W.; Kaiser, C.A. Competition between glutathione and protein thiols for disulphide-bond formation. Nat. Cell Biol. 1999, 1, 130–135. [Google Scholar] [CrossRef] [PubMed]
- Stipanuk, M.H.; Coloso, R.M.; Garcia, R.A.; Banks, M.F. Cysteine concentration regulates cysteine metabolism to glutathione, sulfate and taurine in rat hepatocytes. J. Nutr. 1992, 122, 420–427. [Google Scholar] [CrossRef] [PubMed]
- Kwon, Y.H.; Stipanuk, M.H. Cysteine regulates expression of cysteine dioxygenase and gamma-glutamylcysteine synthetase in cultured rat hepatocytes. Am. J. Physiol. Endocrinol. Metab. 2001, 280, E804–E815. [Google Scholar] [CrossRef] [Green Version]
Symbol | Primer Sequence (5′-3′) | |
---|---|---|
Forward | Reverse | |
MTTP | CTCTTGGCAGTGCTTTTTCTCT | GAGCTTGTATAGCCGCTCATT |
ApoB | TTGGCAAACTGCATAGCATCC | TCAAATTGGGACTCTCCTTTAGC |
XBP1 | GAGTCCGCAGCAGGTG | GTGTCAGAGTCCATGGGA |
BiP | ATCAGGGCAACCGCATCAC | TGATGTCCTGCTGCACCGAA |
CHOP | CACGCACATCCCAAAGCC | GGGCACTGACCACTCTGTT |
β-actin | CTGTCCCTGTATGCCTCTG | ATGTCACGCACGATTTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, S.H.; Seo, H.; Kwon, D.; Yuk, D.Y.; Jung, Y.-S. Taurine Ameliorates Tunicamycin-Induced Liver Injury by Disrupting the Vicious Cycle between Oxidative Stress and Endoplasmic Reticulum Stress. Life 2022, 12, 354. https://doi.org/10.3390/life12030354
Kim SH, Seo H, Kwon D, Yuk DY, Jung Y-S. Taurine Ameliorates Tunicamycin-Induced Liver Injury by Disrupting the Vicious Cycle between Oxidative Stress and Endoplasmic Reticulum Stress. Life. 2022; 12(3):354. https://doi.org/10.3390/life12030354
Chicago/Turabian StyleKim, Sou Hyun, Hyeji Seo, Doyoung Kwon, Dong Yeon Yuk, and Young-Suk Jung. 2022. "Taurine Ameliorates Tunicamycin-Induced Liver Injury by Disrupting the Vicious Cycle between Oxidative Stress and Endoplasmic Reticulum Stress" Life 12, no. 3: 354. https://doi.org/10.3390/life12030354