Scribd Logo
Hochladen

Welcome to Scribd!

  • Catch A Killer

    Uploaded by

    Savannah Quimby
    3K views3 pages
    Dr. Johnson, a geneticist, was attacked by a killer but escaped. He sent genetic codes as clues about the identity and weapon used. The student analyzed the codes to get amino acid sequences and clues about the suspect (Lawyer), weapon (hatchet), and other identifying features (facial hair, featherless, sharp). Based on the clues, the student concluded the Lawyer used a hatchet to try to kill Dr. Johnson.

    Original Description:

    biology

    Original Title

    Catch a Killer

    Copyright

    © © All Rights Reserved

    Available Formats

    DOCX, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    Report this Document
    Dr. Johnson, a geneticist, was attacked by a killer but escaped. He sent genetic codes as clues about the identity and weapon used. The student analyzed the codes to get amino acid sequences and clues about the suspect (Lawyer), weapon (hatchet), and other identifying features (facial hair, featherless, sharp). Based on the clues, the student concluded the Lawyer used a hatchet to try to kill Dr. Johnson.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Flag for inappropriate content
    Download as docx, pdf, or txt
    3K views3 pages

    Catch A Killer

    Uploaded by

    Savannah Quimby
    Dr. Johnson, a geneticist, was attacked by a killer but escaped. He sent genetic codes as clues about the identity and weapon used. The student analyzed the codes to get amino acid sequences and clues about the suspect (Lawyer), weapon (hatchet), and other identifying features (facial hair, featherless, sharp). Based on the clues, the student concluded the Lawyer used a hatchet to try to kill Dr. Johnson.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Flag for inappropriate content
    Download as docx, pdf, or txt
    of 3

    Name: ___Savannah Quimby___________________ Date: _12-2___________

    Catch the Killer


    Dr. Johnson was recently attacked by a crazed killer, and luckily, he was able to escape. He has
    gone into hiding out of fear that he will be attacked again, but he has sent several clues about the identity of
    his attacker. Because Dr. Johnson is a geneticist, he has sent his clues in the form of a special code: the
    genetic code. Your job is to transcribe and translate these messages to determine the correct amino acid
    sequence. After each sequence is translated, write the single letter abbreviation for each amino acid to
    discover the clue. Use the clues to determine which suspect and weapon were used in the attack.

    The Suspects:

    Judge Deputy Oil Tycoon

    Lawyer Professor

    The Weapons:

    Poison Hatchet Knife


    Example DNA message: TTCTAGGAGGACCTCGCC

    Transcription: __AAGAUCCUCCUGGAGCGG_________________________
    Translation: _Lys lle Leu Leu Glu Arg______________________________________
    What is the Clue? _____killer__________________________________________________________
    DNA message #1: GTACGATGTACAGTGCTTTGA
    Transcription: ____CAU GCU ACA UGU CAC GAA ACU_________________________________________
    Translation: _____his ala thr cys his glu thr___________________________________________
    What is the Clue? __hatchet_____________________________________________________________
    DNA message #2: GAGCGCACCATACTTTCC
    Transcription: __CUCGCGUGGUAUGAAAGG___________________________________________
    Translation: ___PHE ALA TRP TYR GLU ARG__________________________________________
    What is the Clue? __LAWYER_____________________________________________________________
    DNA message #3: AAGCGAACATATCGTGACGTGCGGTAAGCC
    Transcription: __UUC GCU UGU AUA GCA CUG CAC GCC AUU________________________
    Translation: ___PHE ALA CYS LLE ALA LEU HIS ALA LLE ARG________________________________________
    What is the Clue? ___FACIAL HAIR____________________________________________________________
    DNA message #4: AAACTTCGCTGGGTGCTCTCCAACCTTTCATCG
    Transcription: _____UUU GAA GCG ACC CAC GAG AGG UUG GAA AGU AGC________________________
    Translation: ______PHE GLU ALA THR GIS GLU ARG LEU GLU SER SER_______________________
    What is the Clue? ______FEATHERLESS_________________________________________________________
    DNA message #5: AGTGTGCGGGCCGGG
    Transcription: ________UCA CAC GCC CGG CCC_______________________________________
    Translation: _____SER HIS ALA ARG PRO_____________________________________________
    What is the Clue? ___SHARP______________________________________________________
    1. Based on the clues, who do you think tried to kill Dr. Johnson?
    ___THE LAWYER_____________________________________________________
    2. What weapon do you think this suspect used? _____HATCHET________________

    You might also like